Incidental Mutation 'R7293:Dvl1'
ID566543
Institutional Source Beutler Lab
Gene Symbol Dvl1
Ensembl Gene ENSMUSG00000029071
Gene Namedishevelled segment polarity protein 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7293 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location155847402-155859303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155856168 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 415 (M415T)
Ref Sequence ENSEMBL: ENSMUSP00000030948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030948] [ENSMUST00000030949] [ENSMUST00000168552]
PDB Structure
STRUCTURAL BASIS OF THE RECOGNITION OF THE DISHEVELLED DEP DOMAIN IN THE WNT SIGNALING PATHWAY [SOLUTION NMR]
Solution Structure of mDvl1 PDZ domain [SOLUTION NMR]
NMR structure of the mDvl1 PDZ domain in complex with its inhibitor [SOLUTION NMR]
Crystal structure of Dvl1-DIX(Y17D) mutant [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030948
AA Change: M415T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071
AA Change: M415T

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 144 215 1.1e-31 PFAM
low complexity region 217 233 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 4.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030949
SMART Domains Protein: ENSMUSP00000030949
Gene: ENSMUSG00000029072

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 72 469 2e-79 PFAM
Pfam:NCD3G 500 552 1.9e-16 PFAM
Pfam:7tm_3 576 821 9.6e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168552
AA Change: M415T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071
AA Change: M415T

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 90 247 1.7e-60 PFAM
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 7.6e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Dishevelled family of proteins. These proteins have an N-terminal Dishevelled/Axin domain, a Dishevelled, EGL-10, Plextrin domain, a central PDZ domain, and a C-terminal domain of approximately 200 amino acids. They regulate both canonical and non-canonical Wnt signaling as well as planar cell polarity pathways. Mice deficient for this gene are viable and fertile but display reduced social interaction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous targeted mutants are viable and fertile, but show a number of behavioral changes including deficient nest-building, less huddling contact during sleep, reduced subordinate responses, and other social interaction deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A T 3: 92,868,819 C186S probably benign Het
Abcc2 G A 19: 43,807,053 G416E probably damaging Het
Acsl5 G T 19: 55,291,210 W460L probably damaging Het
Adam2 A G 14: 66,035,185 F614S probably benign Het
Adamts5 G A 16: 85,899,945 T108I probably benign Het
Agmat C T 4: 141,755,935 Q227* probably null Het
Alg11 A G 8: 22,065,379 N219D probably damaging Het
Amhr2 A G 15: 102,447,393 T258A probably benign Het
Ankrd53 A G 6: 83,763,196 E82G probably null Het
Blzf1 T A 1: 164,295,883 T292S possibly damaging Het
Capza1 T C 3: 104,840,835 D71G probably benign Het
Cc2d1b T C 4: 108,631,676 F770L probably benign Het
Cckbr A T 7: 105,434,645 Q260L probably benign Het
Cep162 T C 9: 87,203,783 T1163A probably benign Het
Chd9 T C 8: 91,034,079 S2151P unknown Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Cmya5 T A 13: 93,092,797 S1928C possibly damaging Het
Col24a1 C T 3: 145,486,304 Q1273* probably null Het
Col4a4 T C 1: 82,523,943 D363G unknown Het
Copb1 A T 7: 114,219,602 M827K probably damaging Het
Crocc C T 4: 141,043,556 A351T probably benign Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Csrnp3 A G 2: 65,949,000 R19G probably damaging Het
Cyb5rl T C 4: 107,080,946 I165T probably damaging Het
Dnah1 A T 14: 31,287,863 I1916N probably damaging Het
Dync2h1 A G 9: 7,001,454 S3845P possibly damaging Het
Eif3b A G 5: 140,419,428 Q23R probably benign Het
Esam G T 9: 37,537,724 R376L probably damaging Het
Fat3 G C 9: 15,915,040 H391D Het
Fat3 A C 9: 15,915,296 S305R Het
Fgd3 T C 13: 49,264,658 D644G probably benign Het
Fgf7 T C 2: 126,035,752 L13P probably damaging Het
Gas2l1 A G 11: 5,064,338 Y41H probably damaging Het
Glg1 A T 8: 111,168,743 I812N probably damaging Het
Glp1r C T 17: 30,924,625 H212Y probably benign Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gpr158 G A 2: 21,576,939 V410I possibly damaging Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Itgb2l A C 16: 96,426,796 Y502* probably null Het
Jakmip1 G A 5: 37,127,473 V635I probably benign Het
Krt23 C T 11: 99,483,856 M270I probably benign Het
Larp1b C T 3: 40,985,444 A344V Het
Lin28b T C 10: 45,419,186 M134V probably benign Het
Lrrc19 T A 4: 94,638,390 Y310F probably benign Het
Lyst T A 13: 13,680,237 D2397E probably benign Het
Map6 A G 7: 99,336,533 N751S possibly damaging Het
Mgrn1 G A 16: 4,932,220 D494N probably benign Het
Myh6 A G 14: 54,947,174 F1567L probably benign Het
Myo9b T C 8: 71,325,905 V461A probably benign Het
Ncan A T 8: 70,115,211 S84T probably damaging Het
Nlrp9a G A 7: 26,571,269 C908Y probably damaging Het
Olfr1264 A T 2: 90,021,527 Y180N probably damaging Het
Olfr1289 A G 2: 111,483,354 probably null Het
Olfr659 T A 7: 104,670,718 N5K probably damaging Het
Olfr949-ps1 A T 9: 39,364,834 M92L probably benign Het
Parp4 CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATATTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC 14: 56,647,846 probably benign Het
Pld1 C A 3: 28,087,286 T666K probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Pramel7 A C 2: 87,492,362 N19K probably benign Het
Prh1 C G 6: 132,571,758 P76R unknown Het
Prkd2 T C 7: 16,845,940 V121A possibly damaging Het
Ptprq G A 10: 107,635,506 Q1345* probably null Het
Ryr3 T A 2: 112,902,603 T653S probably benign Het
Sall2 G T 14: 52,314,411 Y442* probably null Het
Slc23a2 A C 2: 132,089,106 F158V probably benign Het
Smg1 C A 7: 118,166,099 R1954L unknown Het
Snx31 G A 15: 36,523,450 T362I probably damaging Het
Taf3 G T 2: 9,952,090 T422K probably damaging Het
Tcfl5 T C 2: 180,642,165 D142G probably benign Het
Tmx1 A G 12: 70,460,551 T188A probably damaging Het
Tnfrsf11a A G 1: 105,808,141 probably null Het
Trio A T 15: 27,871,289 C640S possibly damaging Het
Ulk4 T G 9: 121,255,124 N427T probably damaging Het
Vmn1r202 T C 13: 22,501,702 M182V probably benign Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Other mutations in Dvl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Dvl1 APN 4 155853698 missense possibly damaging 0.85
IGL01930:Dvl1 APN 4 155856188 missense possibly damaging 0.72
IGL02499:Dvl1 APN 4 155854780 missense probably benign 0.10
IGL03075:Dvl1 APN 4 155854583 missense probably damaging 0.99
IGL03089:Dvl1 APN 4 155855152 missense probably damaging 1.00
R0525:Dvl1 UTSW 4 155855595 missense probably damaging 0.99
R0624:Dvl1 UTSW 4 155854775 missense probably damaging 1.00
R0633:Dvl1 UTSW 4 155858295 missense probably damaging 1.00
R1459:Dvl1 UTSW 4 155854019 missense probably damaging 0.99
R1955:Dvl1 UTSW 4 155858029 missense possibly damaging 0.69
R1991:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2144:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2145:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2156:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2191:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2192:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2290:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2292:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2304:Dvl1 UTSW 4 155855584 missense probably damaging 0.98
R2519:Dvl1 UTSW 4 155855543 nonsense probably null
R3082:Dvl1 UTSW 4 155847859 missense possibly damaging 0.92
R3110:Dvl1 UTSW 4 155853666 missense probably damaging 0.98
R3112:Dvl1 UTSW 4 155853666 missense probably damaging 0.98
R4775:Dvl1 UTSW 4 155858127 missense probably benign
R5384:Dvl1 UTSW 4 155853686 missense probably damaging 0.99
R6148:Dvl1 UTSW 4 155854952 missense probably damaging 1.00
R6563:Dvl1 UTSW 4 155856253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCTACGTGGACTTGCAC -3'
(R):5'- GCCACAGGTCCATCAAAGTC -3'

Sequencing Primer
(F):5'- GGGGAAGAATCTCCCGGTCTTAG -3'
(R):5'- TCCATCAAAGTCAGGGTAGCTG -3'
Posted On2019-06-26