Incidental Mutation 'R7293:Olfr659'
ID566551
Institutional Source Beutler Lab
Gene Symbol Olfr659
Ensembl Gene ENSMUSG00000073922
Gene Nameolfactory receptor 659
SynonymsGA_x6K02T2PBJ9-7298889-7299857, MOR34-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7293 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104666753-104674948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104670718 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 5 (N5K)
Ref Sequence ENSEMBL: ENSMUSP00000149939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098170] [ENSMUST00000214986]
Predicted Effect probably damaging
Transcript: ENSMUST00000098170
AA Change: N5K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095772
Gene: ENSMUSG00000073922
AA Change: N5K

DomainStartEndE-ValueType
Pfam:7tm_4 33 314 5.2e-99 PFAM
Pfam:7TM_GPCR_Srsx 37 256 7.2e-9 PFAM
Pfam:7tm_1 43 296 4.7e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214986
AA Change: N5K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A T 3: 92,868,819 C186S probably benign Het
Abcc2 G A 19: 43,807,053 G416E probably damaging Het
Acsl5 G T 19: 55,291,210 W460L probably damaging Het
Adam2 A G 14: 66,035,185 F614S probably benign Het
Adamts5 G A 16: 85,899,945 T108I probably benign Het
Agmat C T 4: 141,755,935 Q227* probably null Het
Alg11 A G 8: 22,065,379 N219D probably damaging Het
Amhr2 A G 15: 102,447,393 T258A probably benign Het
Ankrd53 A G 6: 83,763,196 E82G probably null Het
Blzf1 T A 1: 164,295,883 T292S possibly damaging Het
Capza1 T C 3: 104,840,835 D71G probably benign Het
Cc2d1b T C 4: 108,631,676 F770L probably benign Het
Cckbr A T 7: 105,434,645 Q260L probably benign Het
Cep162 T C 9: 87,203,783 T1163A probably benign Het
Chd9 T C 8: 91,034,079 S2151P unknown Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Cmya5 T A 13: 93,092,797 S1928C possibly damaging Het
Col24a1 C T 3: 145,486,304 Q1273* probably null Het
Col4a4 T C 1: 82,523,943 D363G unknown Het
Copb1 A T 7: 114,219,602 M827K probably damaging Het
Crocc C T 4: 141,043,556 A351T probably benign Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Csrnp3 A G 2: 65,949,000 R19G probably damaging Het
Cyb5rl T C 4: 107,080,946 I165T probably damaging Het
Dnah1 A T 14: 31,287,863 I1916N probably damaging Het
Dvl1 T C 4: 155,856,168 M415T possibly damaging Het
Dync2h1 A G 9: 7,001,454 S3845P possibly damaging Het
Eif3b A G 5: 140,419,428 Q23R probably benign Het
Esam G T 9: 37,537,724 R376L probably damaging Het
Fat3 G C 9: 15,915,040 H391D Het
Fat3 A C 9: 15,915,296 S305R Het
Fgd3 T C 13: 49,264,658 D644G probably benign Het
Fgf7 T C 2: 126,035,752 L13P probably damaging Het
Gas2l1 A G 11: 5,064,338 Y41H probably damaging Het
Glg1 A T 8: 111,168,743 I812N probably damaging Het
Glp1r C T 17: 30,924,625 H212Y probably benign Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gpr158 G A 2: 21,576,939 V410I possibly damaging Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Itgb2l A C 16: 96,426,796 Y502* probably null Het
Jakmip1 G A 5: 37,127,473 V635I probably benign Het
Krt23 C T 11: 99,483,856 M270I probably benign Het
Larp1b C T 3: 40,985,444 A344V Het
Lin28b T C 10: 45,419,186 M134V probably benign Het
Lrrc19 T A 4: 94,638,390 Y310F probably benign Het
Lyst T A 13: 13,680,237 D2397E probably benign Het
Map6 A G 7: 99,336,533 N751S possibly damaging Het
Mgrn1 G A 16: 4,932,220 D494N probably benign Het
Myh6 A G 14: 54,947,174 F1567L probably benign Het
Myo9b T C 8: 71,325,905 V461A probably benign Het
Ncan A T 8: 70,115,211 S84T probably damaging Het
Nlrp9a G A 7: 26,571,269 C908Y probably damaging Het
Olfr1264 A T 2: 90,021,527 Y180N probably damaging Het
Olfr949-ps1 A T 9: 39,364,834 M92L probably benign Het
Parp4 CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATATTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC 14: 56,647,846 probably benign Het
Pld1 C A 3: 28,087,286 T666K probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Pramel7 A C 2: 87,492,362 N19K probably benign Het
Prh1 C G 6: 132,571,758 P76R unknown Het
Prkd2 T C 7: 16,845,940 V121A possibly damaging Het
Ptprq G A 10: 107,635,506 Q1345* probably null Het
Ryr3 T A 2: 112,902,603 T653S probably benign Het
Sall2 G T 14: 52,314,411 Y442* probably null Het
Slc23a2 A C 2: 132,089,106 F158V probably benign Het
Smg1 C A 7: 118,166,099 R1954L unknown Het
Snx31 G A 15: 36,523,450 T362I probably damaging Het
Taf3 G T 2: 9,952,090 T422K probably damaging Het
Tcfl5 T C 2: 180,642,165 D142G probably benign Het
Tmx1 A G 12: 70,460,551 T188A probably damaging Het
Tnfrsf11a A G 1: 105,808,141 probably null Het
Trio A T 15: 27,871,289 C640S possibly damaging Het
Ulk4 T G 9: 121,255,124 N427T probably damaging Het
Vmn1r202 T C 13: 22,501,702 M182V probably benign Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Other mutations in Olfr659
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Olfr659 APN 7 104671071 missense probably damaging 1.00
IGL01640:Olfr659 APN 7 104671664 missense probably damaging 0.96
IGL01774:Olfr659 APN 7 104670942 missense probably benign 0.01
IGL01912:Olfr659 APN 7 104671233 missense possibly damaging 0.91
IGL02338:Olfr659 APN 7 104671681 utr 3 prime probably benign
IGL02611:Olfr659 APN 7 104671407 missense possibly damaging 0.91
IGL02707:Olfr659 APN 7 104670929 missense probably damaging 0.97
R1139:Olfr659 UTSW 7 104670891 missense probably damaging 1.00
R1283:Olfr659 UTSW 7 104670943 missense possibly damaging 0.94
R1867:Olfr659 UTSW 7 104671317 missense possibly damaging 0.89
R2004:Olfr659 UTSW 7 104671601 missense possibly damaging 0.88
R2265:Olfr659 UTSW 7 104670860 missense probably benign 0.00
R4057:Olfr659 UTSW 7 104671269 missense probably damaging 1.00
R4519:Olfr659 UTSW 7 104670839 missense probably damaging 1.00
R4735:Olfr659 UTSW 7 104670993 missense probably benign
R4745:Olfr659 UTSW 7 104671504 missense probably damaging 1.00
R4816:Olfr659 UTSW 7 104670735 missense probably benign 0.04
R5274:Olfr659 UTSW 7 104671526 missense probably damaging 0.99
R6299:Olfr659 UTSW 7 104670868 missense probably benign 0.08
R6312:Olfr659 UTSW 7 104671589 missense probably damaging 1.00
R6770:Olfr659 UTSW 7 104671518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAATGAGCCCTATTAATGGC -3'
(R):5'- TCTGTAAGGGAAAGCATAGCC -3'

Sequencing Primer
(F):5'- GAGCGATGAGGATTTATCTTT -3'
(R):5'- CCAAGAAGTAGTACATTGACCTGTG -3'
Posted On2019-06-26