Incidental Mutation 'R7293:Cmya5'
ID566579
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Namecardiomyopathy associated 5
SynonymsMyospryn, 2310076E21Rik, 2310076E16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R7293 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location93040713-93144724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93092797 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 1928 (S1928C)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062122
AA Change: S1928C

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: S1928C

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A T 3: 92,868,819 C186S probably benign Het
Abcc2 G A 19: 43,807,053 G416E probably damaging Het
Acsl5 G T 19: 55,291,210 W460L probably damaging Het
Adam2 A G 14: 66,035,185 F614S probably benign Het
Adamts5 G A 16: 85,899,945 T108I probably benign Het
Agmat C T 4: 141,755,935 Q227* probably null Het
Alg11 A G 8: 22,065,379 N219D probably damaging Het
Amhr2 A G 15: 102,447,393 T258A probably benign Het
Ankrd53 A G 6: 83,763,196 E82G probably null Het
Blzf1 T A 1: 164,295,883 T292S possibly damaging Het
Capza1 T C 3: 104,840,835 D71G probably benign Het
Cc2d1b T C 4: 108,631,676 F770L probably benign Het
Cckbr A T 7: 105,434,645 Q260L probably benign Het
Cep162 T C 9: 87,203,783 T1163A probably benign Het
Chd9 T C 8: 91,034,079 S2151P unknown Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col24a1 C T 3: 145,486,304 Q1273* probably null Het
Col4a4 T C 1: 82,523,943 D363G unknown Het
Copb1 A T 7: 114,219,602 M827K probably damaging Het
Crocc C T 4: 141,043,556 A351T probably benign Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Csrnp3 A G 2: 65,949,000 R19G probably damaging Het
Cyb5rl T C 4: 107,080,946 I165T probably damaging Het
Dnah1 A T 14: 31,287,863 I1916N probably damaging Het
Dvl1 T C 4: 155,856,168 M415T possibly damaging Het
Dync2h1 A G 9: 7,001,454 S3845P possibly damaging Het
Eif3b A G 5: 140,419,428 Q23R probably benign Het
Esam G T 9: 37,537,724 R376L probably damaging Het
Fat3 G C 9: 15,915,040 H391D Het
Fat3 A C 9: 15,915,296 S305R Het
Fgd3 T C 13: 49,264,658 D644G probably benign Het
Fgf7 T C 2: 126,035,752 L13P probably damaging Het
Gas2l1 A G 11: 5,064,338 Y41H probably damaging Het
Glg1 A T 8: 111,168,743 I812N probably damaging Het
Glp1r C T 17: 30,924,625 H212Y probably benign Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gpr158 G A 2: 21,576,939 V410I possibly damaging Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Itgb2l A C 16: 96,426,796 Y502* probably null Het
Jakmip1 G A 5: 37,127,473 V635I probably benign Het
Krt23 C T 11: 99,483,856 M270I probably benign Het
Larp1b C T 3: 40,985,444 A344V Het
Lin28b T C 10: 45,419,186 M134V probably benign Het
Lrrc19 T A 4: 94,638,390 Y310F probably benign Het
Lyst T A 13: 13,680,237 D2397E probably benign Het
Map6 A G 7: 99,336,533 N751S possibly damaging Het
Mgrn1 G A 16: 4,932,220 D494N probably benign Het
Myh6 A G 14: 54,947,174 F1567L probably benign Het
Myo9b T C 8: 71,325,905 V461A probably benign Het
Ncan A T 8: 70,115,211 S84T probably damaging Het
Nlrp9a G A 7: 26,571,269 C908Y probably damaging Het
Olfr1264 A T 2: 90,021,527 Y180N probably damaging Het
Olfr1289 A G 2: 111,483,354 probably null Het
Olfr659 T A 7: 104,670,718 N5K probably damaging Het
Olfr949-ps1 A T 9: 39,364,834 M92L probably benign Het
Parp4 CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATATTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC 14: 56,647,846 probably benign Het
Pld1 C A 3: 28,087,286 T666K probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Pramel7 A C 2: 87,492,362 N19K probably benign Het
Prh1 C G 6: 132,571,758 P76R unknown Het
Prkd2 T C 7: 16,845,940 V121A possibly damaging Het
Ptprq G A 10: 107,635,506 Q1345* probably null Het
Ryr3 T A 2: 112,902,603 T653S probably benign Het
Sall2 G T 14: 52,314,411 Y442* probably null Het
Slc23a2 A C 2: 132,089,106 F158V probably benign Het
Smg1 C A 7: 118,166,099 R1954L unknown Het
Snx31 G A 15: 36,523,450 T362I probably damaging Het
Taf3 G T 2: 9,952,090 T422K probably damaging Het
Tcfl5 T C 2: 180,642,165 D142G probably benign Het
Tmx1 A G 12: 70,460,551 T188A probably damaging Het
Tnfrsf11a A G 1: 105,808,141 probably null Het
Trio A T 15: 27,871,289 C640S possibly damaging Het
Ulk4 T G 9: 121,255,124 N427T probably damaging Het
Vmn1r202 T C 13: 22,501,702 M182V probably benign Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93093120 missense probably benign 0.13
IGL00516:Cmya5 APN 13 93098167 missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93094161 missense probably benign 0.00
IGL00948:Cmya5 APN 13 93091036 missense probably benign
IGL00966:Cmya5 APN 13 93097906 missense probably benign 0.33
IGL00988:Cmya5 APN 13 93097933 missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93084612 missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93096946 missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93089206 missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93094027 missense probably benign
IGL01679:Cmya5 APN 13 93065320 missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93089299 missense probably benign 0.00
IGL01861:Cmya5 APN 13 93089748 missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93094549 missense probably benign 0.00
IGL02034:Cmya5 APN 13 93084535 splice site probably benign
IGL02103:Cmya5 APN 13 93092127 missense probably benign 0.05
IGL02174:Cmya5 APN 13 93048907 missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93090150 missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93092734 missense probably benign 0.14
IGL02229:Cmya5 APN 13 93092686 missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93098019 missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93090655 missense probably benign 0.40
IGL02409:Cmya5 APN 13 93090198 missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93091858 missense probably benign 0.00
IGL02676:Cmya5 APN 13 93092853 missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93090997 nonsense probably null
IGL02685:Cmya5 APN 13 93090997 nonsense probably null
IGL02686:Cmya5 APN 13 93090997 nonsense probably null
IGL02724:Cmya5 APN 13 93096655 missense probably benign
IGL02727:Cmya5 APN 13 93098245 missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93092557 missense probably benign 0.41
IGL03079:Cmya5 APN 13 93097701 missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93090868 missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93091270 nonsense probably null
IGL03336:Cmya5 APN 13 93093505 missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93065342 missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93089346 missense probably benign 0.22
P4748:Cmya5 UTSW 13 93074475 splice site probably benign
R0123:Cmya5 UTSW 13 93095904 missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0331:Cmya5 UTSW 13 93144403 missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93094869 missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93092748 missense probably benign 0.06
R0416:Cmya5 UTSW 13 93089856 missense probably benign 0.05
R0446:Cmya5 UTSW 13 93093656 missense probably benign
R0457:Cmya5 UTSW 13 93095587 missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93089997 missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93092791 missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93093849 nonsense probably null
R0698:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93094446 missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93095112 missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93041535 missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93041525 missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93092058 missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93065327 missense probably benign 0.44
R1572:Cmya5 UTSW 13 93094269 missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93063519 missense probably benign 0.27
R1735:Cmya5 UTSW 13 93089789 missense probably benign 0.11
R1743:Cmya5 UTSW 13 93097317 missense probably benign 0.33
R1750:Cmya5 UTSW 13 93095663 missense probably benign
R1827:Cmya5 UTSW 13 93074448 missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93090524 missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93092812 missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93069383 missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93093495 missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93093702 missense probably benign 0.15
R2497:Cmya5 UTSW 13 93098005 missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93093558 missense probably benign 0.41
R2917:Cmya5 UTSW 13 93091064 nonsense probably null
R2944:Cmya5 UTSW 13 93092842 nonsense probably null
R3039:Cmya5 UTSW 13 93092250 missense probably benign 0.12
R3078:Cmya5 UTSW 13 93048927 missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93095366 nonsense probably null
R3717:Cmya5 UTSW 13 93092487 missense probably benign 0.12
R3768:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93091219 missense probably benign 0.07
R3888:Cmya5 UTSW 13 93093656 missense probably benign
R3897:Cmya5 UTSW 13 93096681 missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93089199 missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93091956 missense probably benign 0.36
R4471:Cmya5 UTSW 13 93092325 missense probably benign 0.01
R4493:Cmya5 UTSW 13 93094065 missense probably benign
R4495:Cmya5 UTSW 13 93094065 missense probably benign
R4544:Cmya5 UTSW 13 93091918 nonsense probably null
R4545:Cmya5 UTSW 13 93091918 nonsense probably null
R4624:Cmya5 UTSW 13 93063551 missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93093574 missense probably benign 0.04
R4965:Cmya5 UTSW 13 93095787 missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93090585 missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93091603 missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93093372 missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93096061 missense probably benign 0.00
R5220:Cmya5 UTSW 13 93092296 missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93096195 missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93083273 missense probably benign 0.28
R5356:Cmya5 UTSW 13 93063485 missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93091968 missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93095199 missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93092763 missense probably benign 0.15
R5628:Cmya5 UTSW 13 93089710 missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93045949 missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93098176 missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93045866 critical splice donor site probably null
R5806:Cmya5 UTSW 13 93093937 missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93092780 missense probably benign 0.04
R5872:Cmya5 UTSW 13 93097435 missense probably benign 0.01
R5875:Cmya5 UTSW 13 93095184 missense probably benign 0.13
R5896:Cmya5 UTSW 13 93045865 critical splice donor site probably null
R5910:Cmya5 UTSW 13 93092643 missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93089544 missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93089649 missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93144513 unclassified probably benign
R6102:Cmya5 UTSW 13 93094231 missense probably benign
R6117:Cmya5 UTSW 13 93095166 missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93093444 missense possibly damaging 0.61
R6188:Cmya5 UTSW 13 93097276 missense possibly damaging 0.73
R6219:Cmya5 UTSW 13 93094443 missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93093306 missense probably benign 0.41
R6346:Cmya5 UTSW 13 93092190 missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93074464 missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93089215 missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93089808 missense probably benign 0.05
R6649:Cmya5 UTSW 13 93098025 missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93092895 missense probably benign 0.04
R6652:Cmya5 UTSW 13 93093039 missense probably damaging 0.99
R6669:Cmya5 UTSW 13 93093259 missense probably benign 0.03
R6881:Cmya5 UTSW 13 93090292 missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93091252 missense probably benign 0.04
R6933:Cmya5 UTSW 13 93095136 missense probably benign 0.03
R7021:Cmya5 UTSW 13 93093555 missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93069278 critical splice donor site probably null
R7068:Cmya5 UTSW 13 93092697 missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93090975 missense probably benign 0.00
R7088:Cmya5 UTSW 13 93091864 missense possibly damaging 0.95
R7126:Cmya5 UTSW 13 93089940 missense probably benign 0.41
R7177:Cmya5 UTSW 13 93095328 missense probably benign 0.00
R7188:Cmya5 UTSW 13 93046038 missense probably damaging 1.00
R7217:Cmya5 UTSW 13 93090430 missense probably damaging 1.00
R7278:Cmya5 UTSW 13 93095700 missense probably damaging 0.96
R7332:Cmya5 UTSW 13 93092553 missense possibly damaging 0.60
R7375:Cmya5 UTSW 13 93091661 missense probably damaging 0.97
R7386:Cmya5 UTSW 13 93069323 missense probably damaging 1.00
R7489:Cmya5 UTSW 13 93091838 missense possibly damaging 0.87
R7529:Cmya5 UTSW 13 93097434 missense probably benign 0.02
R7552:Cmya5 UTSW 13 93069312 missense probably benign 0.41
R7624:Cmya5 UTSW 13 93090357 missense possibly damaging 0.79
R7637:Cmya5 UTSW 13 93083212 missense possibly damaging 0.87
R7673:Cmya5 UTSW 13 93094121 missense probably benign 0.13
X0028:Cmya5 UTSW 13 93096687 missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93063579 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGATTTAACTGAAACGCCTTTGG -3'
(R):5'- CAACGTGGAAGTACTCACCC -3'

Sequencing Primer
(F):5'- CCTTTGGGCTCCTCGGC -3'
(R):5'- AATCTGTCCCTGCTGTGAAAG -3'
Posted On2019-06-26