Incidental Mutation 'R7293:Sall2'
ID566582
Institutional Source Beutler Lab
Gene Symbol Sall2
Ensembl Gene ENSMUSG00000049532
Gene Namespalt like transcription factor 2
SynonymsMsal-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7293 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52311172-52328762 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 52314411 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 442 (Y442*)
Ref Sequence ENSEMBL: ENSMUSP00000056401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]
Predicted Effect probably null
Transcript: ENSMUST00000058326
AA Change: Y442*
SMART Domains Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: Y442*

DomainStartEndE-ValueType
low complexity region 71 81 N/A INTRINSIC
low complexity region 97 110 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
ZnF_C2H2 372 394 2.57e-3 SMART
ZnF_C2H2 400 422 1.28e-3 SMART
low complexity region 476 501 N/A INTRINSIC
low complexity region 602 627 N/A INTRINSIC
ZnF_C2H2 629 651 1.2e1 SMART
ZnF_C2H2 657 679 1.69e-3 SMART
ZnF_C2H2 689 711 6.88e-4 SMART
low complexity region 719 730 N/A INTRINSIC
low complexity region 747 779 N/A INTRINSIC
low complexity region 799 819 N/A INTRINSIC
low complexity region 829 848 N/A INTRINSIC
ZnF_C2H2 908 930 2.09e-3 SMART
ZnF_C2H2 937 960 1.01e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135523
AA Change: Y440*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A T 3: 92,868,819 C186S probably benign Het
Abcc2 G A 19: 43,807,053 G416E probably damaging Het
Acsl5 G T 19: 55,291,210 W460L probably damaging Het
Adam2 A G 14: 66,035,185 F614S probably benign Het
Adamts5 G A 16: 85,899,945 T108I probably benign Het
Agmat C T 4: 141,755,935 Q227* probably null Het
Alg11 A G 8: 22,065,379 N219D probably damaging Het
Amhr2 A G 15: 102,447,393 T258A probably benign Het
Ankrd53 A G 6: 83,763,196 E82G probably null Het
Blzf1 T A 1: 164,295,883 T292S possibly damaging Het
Capza1 T C 3: 104,840,835 D71G probably benign Het
Cc2d1b T C 4: 108,631,676 F770L probably benign Het
Cckbr A T 7: 105,434,645 Q260L probably benign Het
Cep162 T C 9: 87,203,783 T1163A probably benign Het
Chd9 T C 8: 91,034,079 S2151P unknown Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Cmya5 T A 13: 93,092,797 S1928C possibly damaging Het
Col24a1 C T 3: 145,486,304 Q1273* probably null Het
Col4a4 T C 1: 82,523,943 D363G unknown Het
Copb1 A T 7: 114,219,602 M827K probably damaging Het
Crocc C T 4: 141,043,556 A351T probably benign Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Csrnp3 A G 2: 65,949,000 R19G probably damaging Het
Cyb5rl T C 4: 107,080,946 I165T probably damaging Het
Dnah1 A T 14: 31,287,863 I1916N probably damaging Het
Dvl1 T C 4: 155,856,168 M415T possibly damaging Het
Dync2h1 A G 9: 7,001,454 S3845P possibly damaging Het
Eif3b A G 5: 140,419,428 Q23R probably benign Het
Esam G T 9: 37,537,724 R376L probably damaging Het
Fat3 G C 9: 15,915,040 H391D Het
Fat3 A C 9: 15,915,296 S305R Het
Fgd3 T C 13: 49,264,658 D644G probably benign Het
Fgf7 T C 2: 126,035,752 L13P probably damaging Het
Gas2l1 A G 11: 5,064,338 Y41H probably damaging Het
Glg1 A T 8: 111,168,743 I812N probably damaging Het
Glp1r C T 17: 30,924,625 H212Y probably benign Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gpr158 G A 2: 21,576,939 V410I possibly damaging Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Itgb2l A C 16: 96,426,796 Y502* probably null Het
Jakmip1 G A 5: 37,127,473 V635I probably benign Het
Krt23 C T 11: 99,483,856 M270I probably benign Het
Larp1b C T 3: 40,985,444 A344V Het
Lin28b T C 10: 45,419,186 M134V probably benign Het
Lrrc19 T A 4: 94,638,390 Y310F probably benign Het
Lyst T A 13: 13,680,237 D2397E probably benign Het
Map6 A G 7: 99,336,533 N751S possibly damaging Het
Mgrn1 G A 16: 4,932,220 D494N probably benign Het
Myh6 A G 14: 54,947,174 F1567L probably benign Het
Myo9b T C 8: 71,325,905 V461A probably benign Het
Ncan A T 8: 70,115,211 S84T probably damaging Het
Nlrp9a G A 7: 26,571,269 C908Y probably damaging Het
Olfr1264 A T 2: 90,021,527 Y180N probably damaging Het
Olfr1289 A G 2: 111,483,354 probably null Het
Olfr659 T A 7: 104,670,718 N5K probably damaging Het
Olfr949-ps1 A T 9: 39,364,834 M92L probably benign Het
Parp4 CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATATTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC 14: 56,647,846 probably benign Het
Pld1 C A 3: 28,087,286 T666K probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Pramel7 A C 2: 87,492,362 N19K probably benign Het
Prh1 C G 6: 132,571,758 P76R unknown Het
Prkd2 T C 7: 16,845,940 V121A possibly damaging Het
Ptprq G A 10: 107,635,506 Q1345* probably null Het
Ryr3 T A 2: 112,902,603 T653S probably benign Het
Slc23a2 A C 2: 132,089,106 F158V probably benign Het
Smg1 C A 7: 118,166,099 R1954L unknown Het
Snx31 G A 15: 36,523,450 T362I probably damaging Het
Taf3 G T 2: 9,952,090 T422K probably damaging Het
Tcfl5 T C 2: 180,642,165 D142G probably benign Het
Tmx1 A G 12: 70,460,551 T188A probably damaging Het
Tnfrsf11a A G 1: 105,808,141 probably null Het
Trio A T 15: 27,871,289 C640S possibly damaging Het
Ulk4 T G 9: 121,255,124 N427T probably damaging Het
Vmn1r202 T C 13: 22,501,702 M182V probably benign Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Other mutations in Sall2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01587:Sall2 APN 14 52314571 missense probably damaging 1.00
IGL02152:Sall2 APN 14 52315514 missense probably damaging 1.00
IGL02318:Sall2 APN 14 52315565 missense probably damaging 1.00
IGL02933:Sall2 APN 14 52313027 missense probably benign 0.00
IGL03165:Sall2 APN 14 52314168 missense probably damaging 1.00
R1079:Sall2 UTSW 14 52313203 missense probably benign 0.13
R1295:Sall2 UTSW 14 52313725 missense probably damaging 1.00
R1674:Sall2 UTSW 14 52313836 missense probably damaging 1.00
R1840:Sall2 UTSW 14 52313725 missense probably damaging 1.00
R1989:Sall2 UTSW 14 52314439 missense probably damaging 1.00
R2339:Sall2 UTSW 14 52313356 missense probably damaging 1.00
R3407:Sall2 UTSW 14 52328104 missense probably benign 0.03
R3870:Sall2 UTSW 14 52313994 missense probably damaging 1.00
R3895:Sall2 UTSW 14 52314047 missense probably damaging 0.99
R4059:Sall2 UTSW 14 52314571 missense probably damaging 1.00
R4272:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4273:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4275:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4289:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4503:Sall2 UTSW 14 52313459 missense probably benign
R4592:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4611:Sall2 UTSW 14 52313753 missense probably damaging 1.00
R4615:Sall2 UTSW 14 52312750 missense probably benign 0.20
R4640:Sall2 UTSW 14 52315159 missense probably damaging 0.99
R4693:Sall2 UTSW 14 52314478 missense probably damaging 1.00
R4921:Sall2 UTSW 14 52315393 missense possibly damaging 0.93
R5007:Sall2 UTSW 14 52314493 missense probably damaging 1.00
R5015:Sall2 UTSW 14 52315655 missense possibly damaging 0.92
R5079:Sall2 UTSW 14 52314754 missense probably damaging 1.00
R5419:Sall2 UTSW 14 52313129 missense probably damaging 1.00
R5849:Sall2 UTSW 14 52314247 missense probably benign 0.13
R6229:Sall2 UTSW 14 52313191 missense probably benign
R6397:Sall2 UTSW 14 52315153 missense probably damaging 1.00
R6422:Sall2 UTSW 14 52312724 makesense probably null
R6456:Sall2 UTSW 14 52313593 missense probably damaging 1.00
R6456:Sall2 UTSW 14 52313594 nonsense probably null
R6786:Sall2 UTSW 14 52314621 missense probably damaging 1.00
R7496:Sall2 UTSW 14 52315561 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTGTTGAAAGTAGGGAGCCCAG -3'
(R):5'- ACAAATGCCGCTTTTGTGC -3'

Sequencing Primer
(F):5'- AGTAGGGAGCCCAGGAGCC -3'
(R):5'- TATTCGGCAGTGACAGCG -3'
Posted On2019-06-26