Incidental Mutation 'R7293:Glp1r'
ID566592
Institutional Source Beutler Lab
Gene Symbol Glp1r
Ensembl Gene ENSMUSG00000024027
Gene Nameglucagon-like peptide 1 receptor
SynonymsGLP-1R, GLP1Rc
Accession Numbers

Genbank: NM_021332; MGI: 99571

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7293 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location30901867-30936510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30924625 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 212 (H212Y)
Ref Sequence ENSEMBL: ENSMUSP00000110221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114574]
Predicted Effect probably benign
Transcript: ENSMUST00000114574
AA Change: H212Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110221
Gene: ENSMUSG00000024027
AA Change: H212Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
HormR 58 135 9.88e-27 SMART
Pfam:7tm_2 141 398 7.4e-82 PFAM
low complexity region 440 456 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 7-transmembrane protein that functions as a receptor for glucagon-like peptide 1 (GLP-1) hormone, which stimulates glucose-induced insulin secretion. This receptor, which functions at the cell surface, becomes internalized in response to GLP-1 and GLP-1 analogs, and it plays an important role in the signaling cascades leading to insulin secretion. It also displays neuroprotective effects in animal models. Polymorphisms in this gene are associated with diabetes. The protein is an important drug target for the treatment of type 2 diabetes and stroke. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Glucose tolerance and pancreatic secretion is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A T 3: 92,868,819 C186S probably benign Het
Abcc2 G A 19: 43,807,053 G416E probably damaging Het
Acsl5 G T 19: 55,291,210 W460L probably damaging Het
Adam2 A G 14: 66,035,185 F614S probably benign Het
Adamts5 G A 16: 85,899,945 T108I probably benign Het
Agmat C T 4: 141,755,935 Q227* probably null Het
Alg11 A G 8: 22,065,379 N219D probably damaging Het
Amhr2 A G 15: 102,447,393 T258A probably benign Het
Ankrd53 A G 6: 83,763,196 E82G probably null Het
Blzf1 T A 1: 164,295,883 T292S possibly damaging Het
Capza1 T C 3: 104,840,835 D71G probably benign Het
Cc2d1b T C 4: 108,631,676 F770L probably benign Het
Cckbr A T 7: 105,434,645 Q260L probably benign Het
Cep162 T C 9: 87,203,783 T1163A probably benign Het
Chd9 T C 8: 91,034,079 S2151P unknown Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Cmya5 T A 13: 93,092,797 S1928C possibly damaging Het
Col24a1 C T 3: 145,486,304 Q1273* probably null Het
Col4a4 T C 1: 82,523,943 D363G unknown Het
Copb1 A T 7: 114,219,602 M827K probably damaging Het
Crocc C T 4: 141,043,556 A351T probably benign Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Csrnp3 A G 2: 65,949,000 R19G probably damaging Het
Cyb5rl T C 4: 107,080,946 I165T probably damaging Het
Dnah1 A T 14: 31,287,863 I1916N probably damaging Het
Dvl1 T C 4: 155,856,168 M415T possibly damaging Het
Dync2h1 A G 9: 7,001,454 S3845P possibly damaging Het
Eif3b A G 5: 140,419,428 Q23R probably benign Het
Esam G T 9: 37,537,724 R376L probably damaging Het
Fat3 G C 9: 15,915,040 H391D Het
Fat3 A C 9: 15,915,296 S305R Het
Fgd3 T C 13: 49,264,658 D644G probably benign Het
Fgf7 T C 2: 126,035,752 L13P probably damaging Het
Gas2l1 A G 11: 5,064,338 Y41H probably damaging Het
Glg1 A T 8: 111,168,743 I812N probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gpr158 G A 2: 21,576,939 V410I possibly damaging Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Itgb2l A C 16: 96,426,796 Y502* probably null Het
Jakmip1 G A 5: 37,127,473 V635I probably benign Het
Krt23 C T 11: 99,483,856 M270I probably benign Het
Larp1b C T 3: 40,985,444 A344V Het
Lin28b T C 10: 45,419,186 M134V probably benign Het
Lrrc19 T A 4: 94,638,390 Y310F probably benign Het
Lyst T A 13: 13,680,237 D2397E probably benign Het
Map6 A G 7: 99,336,533 N751S possibly damaging Het
Mgrn1 G A 16: 4,932,220 D494N probably benign Het
Myh6 A G 14: 54,947,174 F1567L probably benign Het
Myo9b T C 8: 71,325,905 V461A probably benign Het
Ncan A T 8: 70,115,211 S84T probably damaging Het
Nlrp9a G A 7: 26,571,269 C908Y probably damaging Het
Olfr1264 A T 2: 90,021,527 Y180N probably damaging Het
Olfr1289 A G 2: 111,483,354 probably null Het
Olfr659 T A 7: 104,670,718 N5K probably damaging Het
Olfr949-ps1 A T 9: 39,364,834 M92L probably benign Het
Parp4 CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATATTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC 14: 56,647,846 probably benign Het
Pld1 C A 3: 28,087,286 T666K probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Pramel7 A C 2: 87,492,362 N19K probably benign Het
Prh1 C G 6: 132,571,758 P76R unknown Het
Prkd2 T C 7: 16,845,940 V121A possibly damaging Het
Ptprq G A 10: 107,635,506 Q1345* probably null Het
Ryr3 T A 2: 112,902,603 T653S probably benign Het
Sall2 G T 14: 52,314,411 Y442* probably null Het
Slc23a2 A C 2: 132,089,106 F158V probably benign Het
Smg1 C A 7: 118,166,099 R1954L unknown Het
Snx31 G A 15: 36,523,450 T362I probably damaging Het
Taf3 G T 2: 9,952,090 T422K probably damaging Het
Tcfl5 T C 2: 180,642,165 D142G probably benign Het
Tmx1 A G 12: 70,460,551 T188A probably damaging Het
Tnfrsf11a A G 1: 105,808,141 probably null Het
Trio A T 15: 27,871,289 C640S possibly damaging Het
Ulk4 T G 9: 121,255,124 N427T probably damaging Het
Vmn1r202 T C 13: 22,501,702 M182V probably benign Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Other mutations in Glp1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Glp1r APN 17 30901917 missense possibly damaging 0.96
IGL00516:Glp1r APN 17 30925558 missense probably damaging 1.00
IGL00653:Glp1r APN 17 30930760 missense probably damaging 1.00
IGL00917:Glp1r APN 17 30919469 splice site probably benign
IGL02005:Glp1r APN 17 30924611 missense probably benign 0.03
IGL02411:Glp1r APN 17 30924511 missense probably damaging 1.00
IGL02889:Glp1r APN 17 30931144 splice site probably benign
IGL02928:Glp1r APN 17 30918937 missense probably benign 0.00
N/A:Glp1r UTSW 17 30931283 missense probably damaging 0.98
R0135:Glp1r UTSW 17 30924577 missense probably benign 0.00
R0395:Glp1r UTSW 17 30936338 missense probably benign 0.34
R0481:Glp1r UTSW 17 30931217 missense probably benign 0.03
R0602:Glp1r UTSW 17 30909227 missense probably benign 0.12
R0841:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1145:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1145:Glp1r UTSW 17 30919432 missense probably benign 0.01
R1232:Glp1r UTSW 17 30918931 missense probably benign
R1804:Glp1r UTSW 17 30930713 splice site probably null
R1846:Glp1r UTSW 17 30929935 critical splice acceptor site probably null
R1982:Glp1r UTSW 17 30925627 nonsense probably null
R1990:Glp1r UTSW 17 30930748 missense possibly damaging 0.53
R2091:Glp1r UTSW 17 30925549 missense probably damaging 0.97
R3432:Glp1r UTSW 17 30924557 missense probably damaging 1.00
R4456:Glp1r UTSW 17 30918975 nonsense probably null
R4488:Glp1r UTSW 17 30918931 missense probably benign
R4610:Glp1r UTSW 17 30931247 missense probably benign 0.03
R4884:Glp1r UTSW 17 30936266 missense probably damaging 1.00
R5055:Glp1r UTSW 17 30918887 missense probably benign
R6358:Glp1r UTSW 17 30932644 missense probably benign 0.07
R6359:Glp1r UTSW 17 30929972 missense probably damaging 1.00
R6490:Glp1r UTSW 17 30924572 missense probably damaging 0.98
R6698:Glp1r UTSW 17 30936401 missense probably damaging 1.00
R7063:Glp1r UTSW 17 30925558 missense probably damaging 1.00
R7165:Glp1r UTSW 17 30909323 missense probably benign 0.23
R7646:Glp1r UTSW 17 30936283 missense probably benign 0.38
X0064:Glp1r UTSW 17 30919463 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGGTACTGGCTGAAGAGC -3'
(R):5'- GCCATCAGACTAGGAGTTTCCC -3'

Sequencing Primer
(F):5'- CCAGTGTTGGCTGTCATGC -3'
(R):5'- CTAGGAGTTTCCCATAACACTAGGG -3'
Posted On2019-06-26