Incidental Mutation 'R7294:Pax6'
ID566601
Institutional Source Beutler Lab
Gene Symbol Pax6
Ensembl Gene ENSMUSG00000027168
Gene Namepaired box 6
SynonymsGsfaey11, Dey, Dickie's small eye, AEY11, Pax-6, 1500038E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7294 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location105668900-105697364 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 105684901 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 66 (C66*)
Ref Sequence ENSEMBL: ENSMUSP00000087870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090391] [ENSMUST00000090397] [ENSMUST00000111082] [ENSMUST00000111083] [ENSMUST00000111085] [ENSMUST00000111086] [ENSMUST00000111087] [ENSMUST00000111088] [ENSMUST00000142772] [ENSMUST00000156216] [ENSMUST00000167211]
Predicted Effect probably null
Transcript: ENSMUST00000090391
AA Change: C66*
SMART Domains Protein: ENSMUSP00000087870
Gene: ENSMUSG00000027168
AA Change: C66*

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090397
AA Change: C52*
SMART Domains Protein: ENSMUSP00000087878
Gene: ENSMUSG00000027168
AA Change: C52*

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111082
AA Change: C52*
SMART Domains Protein: ENSMUSP00000106711
Gene: ENSMUSG00000027168
AA Change: C52*

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111083
AA Change: C52*
SMART Domains Protein: ENSMUSP00000106712
Gene: ENSMUSG00000027168
AA Change: C52*

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111085
AA Change: C66*
SMART Domains Protein: ENSMUSP00000106714
Gene: ENSMUSG00000027168
AA Change: C66*

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111086
AA Change: C66*
SMART Domains Protein: ENSMUSP00000106715
Gene: ENSMUSG00000027168
AA Change: C66*

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111087
AA Change: C52*
SMART Domains Protein: ENSMUSP00000106716
Gene: ENSMUSG00000027168
AA Change: C52*

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111088
SMART Domains Protein: ENSMUSP00000106717
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
HOX 39 101 4.93e-26 SMART
low complexity region 110 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142772
Predicted Effect probably null
Transcript: ENSMUST00000156216
AA Change: C66*
SMART Domains Protein: ENSMUSP00000119375
Gene: ENSMUSG00000027168
AA Change: C66*

DomainStartEndE-ValueType
PAX 4 139 1.46e-80 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167211
AA Change: C66*
SMART Domains Protein: ENSMUSP00000129344
Gene: ENSMUSG00000027168
AA Change: C66*

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: This gene encodes a homeobox-containing protein that functions as a regulator of transcription. It plays a key role in the development of neural tissues, particularly the eye. Activity of this protein is also required for expression of glucagon in the pancreas. This gene is regulated by multiple enhancers located up to tens or hundreds of kilobases upstream and downstream of the transcription start sites. Mutations in this gene or deletion of these regulatory elements results in severe defects in eye development. Alternative splicing and the use of alternative promoters results in multiple transcript variants, some of which encode proteins that lack the N-terminal paired domain. [provided by RefSeq, Jul 2015]
PHENOTYPE: Null and hypomorphic mutants show a range of phenotypes from viable with small eyes and lens/cornea fusion to microphthalmia and cataract to embryonic or perinatal lethality with anophthalmia and severe craniofacial and forebrain defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,673,582 Y1216* probably null Het
Abca17 G A 17: 24,321,009 T415M not run Het
Adam1a G T 5: 121,520,005 C408* probably null Het
Adamts9 G A 6: 92,894,289 T603M probably damaging Het
Amdhd1 T C 10: 93,534,439 E179G probably benign Het
Bcan T C 3: 87,995,524 T316A possibly damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
C5ar1 T C 7: 16,249,025 I23M probably benign Het
Cd109 A T 9: 78,712,635 E1386D probably damaging Het
Cdcp1 C T 9: 123,177,921 C587Y probably benign Het
Cdh22 A C 2: 165,142,093 V413G possibly damaging Het
Cfap44 A G 16: 44,404,893 probably benign Het
Col2a1 A G 15: 97,987,287 probably null Het
Col6a3 A T 1: 90,828,283 Y95N probably damaging Het
Dusp13 A G 14: 21,733,714 S178P possibly damaging Het
Fhod3 A G 18: 25,132,980 E1575G probably damaging Het
Gfpt2 C T 11: 49,818,608 R209* probably null Het
Gm12169 T A 11: 46,535,612 I182K probably benign Het
Heg1 T C 16: 33,726,489 S573P probably damaging Het
Hinfp A G 9: 44,299,270 C152R probably damaging Het
Hmgcs2 C T 3: 98,290,895 T38I probably benign Het
Jakmip1 T C 5: 37,117,460 F441L possibly damaging Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Kpna4 A C 3: 69,092,623 probably null Het
Krt15 T A 11: 100,132,022 I456F possibly damaging Het
Leprotl1 A T 8: 34,138,852 probably null Het
Muc4 A T 16: 32,756,461 T42S possibly damaging Het
Nat6 T G 9: 107,582,983 F26V possibly damaging Het
Nr1h5 T C 3: 102,945,262 T419A probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1259 A C 2: 89,943,724 Y130* probably null Het
Olfr549 T A 7: 102,554,953 I223N probably damaging Het
Pde10a A T 17: 8,757,021 N53Y probably benign Het
Pdgfra A G 5: 75,181,651 N711S probably benign Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Scn3a A G 2: 65,472,341 S1254P probably damaging Het
Slc26a1 G T 5: 108,673,832 R80S possibly damaging Het
Slc2a4 T C 11: 69,945,399 D262G probably benign Het
Specc1 T A 11: 62,118,337 S226R probably benign Het
Srsf4 A G 4: 131,900,461 S289G unknown Het
Stil T C 4: 115,007,283 V127A probably benign Het
Syne1 A T 10: 5,097,483 probably null Het
Tbc1d22a T A 15: 86,311,835 Y336N possibly damaging Het
Tbc1d8 C T 1: 39,406,762 G116E probably damaging Het
Thrb A G 14: 17,826,963 probably benign Het
Tln1 G T 4: 43,534,399 H2253Q probably benign Het
Tmem131 A C 1: 36,854,847 N158K possibly damaging Het
Toporsl A C 4: 52,611,903 T599P probably benign Het
Tpr C T 1: 150,403,887 R256C probably damaging Het
Triobp C T 15: 78,973,976 A1259V probably damaging Het
Zfp40 A G 17: 23,176,437 I392T possibly damaging Het
Other mutations in Pax6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Pax6 APN 2 105692278 critical splice donor site probably null
IGL02256:Pax6 APN 2 105684770 missense probably benign 0.16
IGL02500:Pax6 APN 2 105692770 missense probably benign 0.13
beady UTSW 2 105691691 missense probably damaging 1.00
red_hots UTSW 2 105695360 missense probably benign 0.00
G1citation:Pax6 UTSW 2 105685923 missense probably benign 0.04
R1067:Pax6 UTSW 2 105680301 missense probably benign 0.01
R1213:Pax6 UTSW 2 105685913 missense probably benign 0.13
R1494:Pax6 UTSW 2 105691610 missense probably benign 0.16
R1633:Pax6 UTSW 2 105691718 missense probably damaging 1.00
R2291:Pax6 UTSW 2 105685883 missense probably benign 0.09
R3834:Pax6 UTSW 2 105696450 missense probably benign 0.00
R3835:Pax6 UTSW 2 105696450 missense probably benign 0.00
R4665:Pax6 UTSW 2 105683998 intron probably benign
R4714:Pax6 UTSW 2 105695400 missense possibly damaging 0.74
R4747:Pax6 UTSW 2 105696502 missense probably benign
R4764:Pax6 UTSW 2 105696502 missense probably benign
R4767:Pax6 UTSW 2 105695360 missense probably benign 0.00
R4771:Pax6 UTSW 2 105696502 missense probably benign
R4772:Pax6 UTSW 2 105696502 missense probably benign
R4816:Pax6 UTSW 2 105683784 intron probably benign
R4819:Pax6 UTSW 2 105692277 critical splice donor site probably null
R5418:Pax6 UTSW 2 105691565 missense probably benign 0.00
R5683:Pax6 UTSW 2 105685907 missense probably benign 0.06
R6041:Pax6 UTSW 2 105683902 missense probably damaging 1.00
R6263:Pax6 UTSW 2 105692854 critical splice donor site probably null
R6651:Pax6 UTSW 2 105685830 missense probably benign 0.00
R6822:Pax6 UTSW 2 105685923 missense probably benign 0.04
R7042:Pax6 UTSW 2 105696373 missense probably benign
R7088:Pax6 UTSW 2 105696408 missense probably benign 0.00
R7102:Pax6 UTSW 2 105692259 missense probably damaging 0.98
R7761:Pax6 UTSW 2 105691691 missense probably damaging 1.00
R7948:Pax6 UTSW 2 105685877 missense probably benign
R8882:Pax6 UTSW 2 105691618 missense possibly damaging 0.96
Z1177:Pax6 UTSW 2 105685816 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AAAGCTCTCTACAGTAAGTTCTCG -3'
(R):5'- GTATGTTATCGTTGGTACAGACCC -3'

Sequencing Primer
(F):5'- CAGTAAGTTCTCGTACCATTGAAGG -3'
(R):5'- GACCCCCTCGGATAATAATCTGTC -3'
Posted On2019-06-26