Incidental Mutation 'R7294:Bpifb9a'
ID 566603
Institutional Source Beutler Lab
Gene Symbol Bpifb9a
Ensembl Gene ENSMUSG00000067998
Gene Name BPI fold containing family B, member 9A
Synonyms 4833413D08Rik, vomeromodulin
MMRRC Submission 045399-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7294 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 154099799-154113165 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 154109616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 504 (T504M)
Ref Sequence ENSEMBL: ENSMUSP00000086314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088924]
AlphaFold Q80XI7
Predicted Effect probably damaging
Transcript: ENSMUST00000088924
AA Change: T504M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000086314
Gene: ENSMUSG00000067998
AA Change: T504M

DomainStartEndE-ValueType
low complexity region 60 77 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
low complexity region 167 181 N/A INTRINSIC
low complexity region 184 203 N/A INTRINSIC
Pfam:LBP_BPI_CETP 216 377 1.1e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (49/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,650,541 (GRCm39) Y1216* probably null Het
Abca17 G A 17: 24,539,983 (GRCm39) T415M not run Het
Adam1a G T 5: 121,658,068 (GRCm39) C408* probably null Het
Adamts9 G A 6: 92,871,270 (GRCm39) T603M probably damaging Het
Amdhd1 T C 10: 93,370,301 (GRCm39) E179G probably benign Het
Bcan T C 3: 87,902,831 (GRCm39) T316A possibly damaging Het
C5ar1 T C 7: 15,982,950 (GRCm39) I23M probably benign Het
Cd109 A T 9: 78,619,917 (GRCm39) E1386D probably damaging Het
Cdcp1 C T 9: 123,006,986 (GRCm39) C587Y probably benign Het
Cdh22 A C 2: 164,984,013 (GRCm39) V413G possibly damaging Het
Cfap44 A G 16: 44,225,256 (GRCm39) probably benign Het
Col2a1 A G 15: 97,885,168 (GRCm39) probably null Het
Col6a3 A T 1: 90,756,005 (GRCm39) Y95N probably damaging Het
Dusp13b A G 14: 21,783,782 (GRCm39) S178P possibly damaging Het
Fhod3 A G 18: 25,266,037 (GRCm39) E1575G probably damaging Het
Gfpt2 C T 11: 49,709,435 (GRCm39) R209* probably null Het
Heg1 T C 16: 33,546,859 (GRCm39) S573P probably damaging Het
Hinfp A G 9: 44,210,567 (GRCm39) C152R probably damaging Het
Hmgcs2 C T 3: 98,198,211 (GRCm39) T38I probably benign Het
Jakmip1 T C 5: 37,274,804 (GRCm39) F441L possibly damaging Het
Kcnj5 A C 9: 32,234,045 (GRCm39) L90R probably damaging Het
Kpna4 A C 3: 68,999,956 (GRCm39) probably null Het
Krt15 T A 11: 100,022,848 (GRCm39) I456F possibly damaging Het
Leprotl1 A T 8: 34,606,006 (GRCm39) probably null Het
Muc4 A T 16: 32,576,835 (GRCm39) T42S possibly damaging Het
Naa80 T G 9: 107,460,182 (GRCm39) F26V possibly damaging Het
Nr1h5 T C 3: 102,852,578 (GRCm39) T419A probably benign Het
Nutm1 G A 2: 112,080,401 (GRCm39) R505C probably damaging Het
Or4c12 A C 2: 89,774,068 (GRCm39) Y130* probably null Het
Or52b3 T A 7: 102,204,160 (GRCm39) I223N probably damaging Het
Pax6 T A 2: 105,515,246 (GRCm39) C66* probably null Het
Pde10a A T 17: 8,975,853 (GRCm39) N53Y probably benign Het
Pdgfra A G 5: 75,342,312 (GRCm39) N711S probably benign Het
Rimkla A T 4: 119,325,663 (GRCm39) S249T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,127 (GRCm39) probably benign Het
Scn3a A G 2: 65,302,685 (GRCm39) S1254P probably damaging Het
Slc26a1 G T 5: 108,821,698 (GRCm39) R80S possibly damaging Het
Slc2a4 T C 11: 69,836,225 (GRCm39) D262G probably benign Het
Specc1 T A 11: 62,009,163 (GRCm39) S226R probably benign Het
Srsf4 A G 4: 131,627,772 (GRCm39) S289G unknown Het
Stil T C 4: 114,864,480 (GRCm39) V127A probably benign Het
Syne1 A T 10: 5,047,483 (GRCm39) probably null Het
Tbc1d22a T A 15: 86,196,036 (GRCm39) Y336N possibly damaging Het
Tbc1d8 C T 1: 39,445,843 (GRCm39) G116E probably damaging Het
Thrb A G 14: 17,826,963 (GRCm38) probably benign Het
Timd5 T A 11: 46,426,439 (GRCm39) I182K probably benign Het
Tln1 G T 4: 43,534,399 (GRCm39) H2253Q probably benign Het
Tmem131 A C 1: 36,893,928 (GRCm39) N158K possibly damaging Het
Toporsl A C 4: 52,611,903 (GRCm39) T599P probably benign Het
Tpr C T 1: 150,279,638 (GRCm39) R256C probably damaging Het
Triobp C T 15: 78,858,176 (GRCm39) A1259V probably damaging Het
Zfp40 A G 17: 23,395,411 (GRCm39) I392T possibly damaging Het
Other mutations in Bpifb9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Bpifb9a APN 2 154,106,195 (GRCm39) nonsense probably null
IGL00899:Bpifb9a APN 2 154,106,647 (GRCm39) splice site probably null
IGL01998:Bpifb9a APN 2 154,110,120 (GRCm39) critical splice donor site probably null
IGL02158:Bpifb9a APN 2 154,108,733 (GRCm39) splice site probably benign
IGL02331:Bpifb9a APN 2 154,104,307 (GRCm39) missense possibly damaging 0.45
R0066:Bpifb9a UTSW 2 154,108,761 (GRCm39) missense possibly damaging 0.95
R0480:Bpifb9a UTSW 2 154,106,608 (GRCm39) missense probably benign 0.33
R0545:Bpifb9a UTSW 2 154,103,870 (GRCm39) nonsense probably null
R0904:Bpifb9a UTSW 2 154,106,145 (GRCm39) splice site probably benign
R1028:Bpifb9a UTSW 2 154,104,327 (GRCm39) missense possibly damaging 0.45
R1158:Bpifb9a UTSW 2 154,104,184 (GRCm39) missense probably benign 0.08
R1465:Bpifb9a UTSW 2 154,112,941 (GRCm39) missense possibly damaging 0.85
R1465:Bpifb9a UTSW 2 154,112,941 (GRCm39) missense possibly damaging 0.85
R1902:Bpifb9a UTSW 2 154,103,911 (GRCm39) missense probably benign 0.00
R2015:Bpifb9a UTSW 2 154,110,120 (GRCm39) critical splice donor site probably null
R2152:Bpifb9a UTSW 2 154,102,055 (GRCm39) missense probably benign 0.28
R2206:Bpifb9a UTSW 2 154,106,161 (GRCm39) splice site probably null
R5410:Bpifb9a UTSW 2 154,112,155 (GRCm39) missense probably benign 0.05
R5731:Bpifb9a UTSW 2 154,104,163 (GRCm39) missense possibly damaging 0.87
R5818:Bpifb9a UTSW 2 154,104,215 (GRCm39) missense probably damaging 0.98
R5865:Bpifb9a UTSW 2 154,108,756 (GRCm39) missense probably benign 0.26
R6564:Bpifb9a UTSW 2 154,102,098 (GRCm39) missense probably benign 0.00
R7291:Bpifb9a UTSW 2 154,109,616 (GRCm39) missense probably damaging 1.00
R7295:Bpifb9a UTSW 2 154,109,616 (GRCm39) missense probably damaging 1.00
R7453:Bpifb9a UTSW 2 154,106,615 (GRCm39) missense probably damaging 0.99
R7570:Bpifb9a UTSW 2 154,104,183 (GRCm39) missense possibly damaging 0.46
R8187:Bpifb9a UTSW 2 154,111,377 (GRCm39) missense probably benign 0.00
R8245:Bpifb9a UTSW 2 154,104,646 (GRCm39) missense probably benign 0.00
R8459:Bpifb9a UTSW 2 154,102,153 (GRCm39) missense probably damaging 0.98
R8481:Bpifb9a UTSW 2 154,111,399 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GACAAAAGGACACATGCCTG -3'
(R):5'- TGGAGTTTGAAATCTTGCTGCC -3'

Sequencing Primer
(F):5'- ATGCCTGCCTCATGAGACAG -3'
(R):5'- AAATCTTGCTGCCATGGGAG -3'
Posted On 2019-06-26