Incidental Mutation 'R7294:Bpifb9a'
ID566603
Institutional Source Beutler Lab
Gene Symbol Bpifb9a
Ensembl Gene ENSMUSG00000067998
Gene NameBPI fold containing family B, member 9A
Synonyms4833413D08Rik, vomeromodulin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7294 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location154257854-154271245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 154267696 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 504 (T504M)
Ref Sequence ENSEMBL: ENSMUSP00000086314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088924]
Predicted Effect probably damaging
Transcript: ENSMUST00000088924
AA Change: T504M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000086314
Gene: ENSMUSG00000067998
AA Change: T504M

DomainStartEndE-ValueType
low complexity region 60 77 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
low complexity region 167 181 N/A INTRINSIC
low complexity region 184 203 N/A INTRINSIC
Pfam:LBP_BPI_CETP 216 377 1.1e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (49/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,673,582 Y1216* probably null Het
Abca17 G A 17: 24,321,009 T415M not run Het
Adam1a G T 5: 121,520,005 C408* probably null Het
Adamts9 G A 6: 92,894,289 T603M probably damaging Het
Amdhd1 T C 10: 93,534,439 E179G probably benign Het
Bcan T C 3: 87,995,524 T316A possibly damaging Het
C5ar1 T C 7: 16,249,025 I23M probably benign Het
Cd109 A T 9: 78,712,635 E1386D probably damaging Het
Cdcp1 C T 9: 123,177,921 C587Y probably benign Het
Cdh22 A C 2: 165,142,093 V413G possibly damaging Het
Cfap44 A G 16: 44,404,893 probably benign Het
Col2a1 A G 15: 97,987,287 probably null Het
Col6a3 A T 1: 90,828,283 Y95N probably damaging Het
Dusp13 A G 14: 21,733,714 S178P possibly damaging Het
Fhod3 A G 18: 25,132,980 E1575G probably damaging Het
Gfpt2 C T 11: 49,818,608 R209* probably null Het
Gm12169 T A 11: 46,535,612 I182K probably benign Het
Heg1 T C 16: 33,726,489 S573P probably damaging Het
Hinfp A G 9: 44,299,270 C152R probably damaging Het
Hmgcs2 C T 3: 98,290,895 T38I probably benign Het
Jakmip1 T C 5: 37,117,460 F441L possibly damaging Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Kpna4 A C 3: 69,092,623 probably null Het
Krt15 T A 11: 100,132,022 I456F possibly damaging Het
Leprotl1 A T 8: 34,138,852 probably null Het
Muc4 A T 16: 32,756,461 T42S possibly damaging Het
Nat6 T G 9: 107,582,983 F26V possibly damaging Het
Nr1h5 T C 3: 102,945,262 T419A probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1259 A C 2: 89,943,724 Y130* probably null Het
Olfr549 T A 7: 102,554,953 I223N probably damaging Het
Pax6 T A 2: 105,684,901 C66* probably null Het
Pde10a A T 17: 8,757,021 N53Y probably benign Het
Pdgfra A G 5: 75,181,651 N711S probably benign Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Scn3a A G 2: 65,472,341 S1254P probably damaging Het
Slc26a1 G T 5: 108,673,832 R80S possibly damaging Het
Slc2a4 T C 11: 69,945,399 D262G probably benign Het
Specc1 T A 11: 62,118,337 S226R probably benign Het
Srsf4 A G 4: 131,900,461 S289G unknown Het
Stil T C 4: 115,007,283 V127A probably benign Het
Syne1 A T 10: 5,097,483 probably null Het
Tbc1d22a T A 15: 86,311,835 Y336N possibly damaging Het
Tbc1d8 C T 1: 39,406,762 G116E probably damaging Het
Thrb A G 14: 17,826,963 probably benign Het
Tln1 G T 4: 43,534,399 H2253Q probably benign Het
Tmem131 A C 1: 36,854,847 N158K possibly damaging Het
Toporsl A C 4: 52,611,903 T599P probably benign Het
Tpr C T 1: 150,403,887 R256C probably damaging Het
Triobp C T 15: 78,973,976 A1259V probably damaging Het
Zfp40 A G 17: 23,176,437 I392T possibly damaging Het
Other mutations in Bpifb9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Bpifb9a APN 2 154264275 nonsense probably null
IGL00899:Bpifb9a APN 2 154264727 splice site probably null
IGL01998:Bpifb9a APN 2 154268200 critical splice donor site probably null
IGL02158:Bpifb9a APN 2 154266813 splice site probably benign
IGL02331:Bpifb9a APN 2 154262387 missense possibly damaging 0.45
R0066:Bpifb9a UTSW 2 154266841 missense possibly damaging 0.95
R0480:Bpifb9a UTSW 2 154264688 missense probably benign 0.33
R0545:Bpifb9a UTSW 2 154261950 nonsense probably null
R0904:Bpifb9a UTSW 2 154264225 splice site probably benign
R1028:Bpifb9a UTSW 2 154262407 missense possibly damaging 0.45
R1158:Bpifb9a UTSW 2 154262264 missense probably benign 0.08
R1465:Bpifb9a UTSW 2 154271021 missense possibly damaging 0.85
R1465:Bpifb9a UTSW 2 154271021 missense possibly damaging 0.85
R1902:Bpifb9a UTSW 2 154261991 missense probably benign 0.00
R2015:Bpifb9a UTSW 2 154268200 critical splice donor site probably null
R2152:Bpifb9a UTSW 2 154260135 missense probably benign 0.28
R2206:Bpifb9a UTSW 2 154264241 splice site probably null
R5410:Bpifb9a UTSW 2 154270235 missense probably benign 0.05
R5731:Bpifb9a UTSW 2 154262243 missense possibly damaging 0.87
R5818:Bpifb9a UTSW 2 154262295 missense probably damaging 0.98
R5865:Bpifb9a UTSW 2 154266836 missense probably benign 0.26
R6564:Bpifb9a UTSW 2 154260178 missense probably benign 0.00
R7291:Bpifb9a UTSW 2 154267696 missense probably damaging 1.00
R7295:Bpifb9a UTSW 2 154267696 missense probably damaging 1.00
R7453:Bpifb9a UTSW 2 154264695 missense probably damaging 0.99
R7570:Bpifb9a UTSW 2 154262263 missense possibly damaging 0.46
R8187:Bpifb9a UTSW 2 154269457 missense probably benign 0.00
R8245:Bpifb9a UTSW 2 154262726 missense probably benign 0.00
R8459:Bpifb9a UTSW 2 154260233 missense probably damaging 0.98
R8481:Bpifb9a UTSW 2 154269479 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACAAAAGGACACATGCCTG -3'
(R):5'- TGGAGTTTGAAATCTTGCTGCC -3'

Sequencing Primer
(F):5'- ATGCCTGCCTCATGAGACAG -3'
(R):5'- AAATCTTGCTGCCATGGGAG -3'
Posted On2019-06-26