Incidental Mutation 'R7294:Toporsl'
ID566609
Institutional Source Beutler Lab
Gene Symbol Toporsl
Ensembl Gene ENSMUSG00000028314
Gene Nametopoisomerase I binding, arginine/serine-rich like
Synonyms4930547C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7294 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location52596274-52612430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 52611903 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 599 (T599P)
Ref Sequence ENSEMBL: ENSMUSP00000029995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029995] [ENSMUST00000107671]
Predicted Effect probably benign
Transcript: ENSMUST00000029995
AA Change: T599P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029995
Gene: ENSMUSG00000028314
AA Change: T599P

DomainStartEndE-ValueType
low complexity region 256 263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107671
AA Change: T599P

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103298
Gene: ENSMUSG00000028314
AA Change: T599P

DomainStartEndE-ValueType
low complexity region 256 263 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (49/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,673,582 Y1216* probably null Het
Abca17 G A 17: 24,321,009 T415M not run Het
Adam1a G T 5: 121,520,005 C408* probably null Het
Adamts9 G A 6: 92,894,289 T603M probably damaging Het
Amdhd1 T C 10: 93,534,439 E179G probably benign Het
Bcan T C 3: 87,995,524 T316A possibly damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
C5ar1 T C 7: 16,249,025 I23M probably benign Het
Cd109 A T 9: 78,712,635 E1386D probably damaging Het
Cdcp1 C T 9: 123,177,921 C587Y probably benign Het
Cdh22 A C 2: 165,142,093 V413G possibly damaging Het
Cfap44 A G 16: 44,404,893 probably benign Het
Col2a1 A G 15: 97,987,287 probably null Het
Col6a3 A T 1: 90,828,283 Y95N probably damaging Het
Dusp13 A G 14: 21,733,714 S178P possibly damaging Het
Fhod3 A G 18: 25,132,980 E1575G probably damaging Het
Gfpt2 C T 11: 49,818,608 R209* probably null Het
Gm12169 T A 11: 46,535,612 I182K probably benign Het
Heg1 T C 16: 33,726,489 S573P probably damaging Het
Hinfp A G 9: 44,299,270 C152R probably damaging Het
Hmgcs2 C T 3: 98,290,895 T38I probably benign Het
Jakmip1 T C 5: 37,117,460 F441L possibly damaging Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Kpna4 A C 3: 69,092,623 probably null Het
Krt15 T A 11: 100,132,022 I456F possibly damaging Het
Leprotl1 A T 8: 34,138,852 probably null Het
Muc4 A T 16: 32,756,461 T42S possibly damaging Het
Nat6 T G 9: 107,582,983 F26V possibly damaging Het
Nr1h5 T C 3: 102,945,262 T419A probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1259 A C 2: 89,943,724 Y130* probably null Het
Olfr549 T A 7: 102,554,953 I223N probably damaging Het
Pax6 T A 2: 105,684,901 C66* probably null Het
Pde10a A T 17: 8,757,021 N53Y probably benign Het
Pdgfra A G 5: 75,181,651 N711S probably benign Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Scn3a A G 2: 65,472,341 S1254P probably damaging Het
Slc26a1 G T 5: 108,673,832 R80S possibly damaging Het
Slc2a4 T C 11: 69,945,399 D262G probably benign Het
Specc1 T A 11: 62,118,337 S226R probably benign Het
Srsf4 A G 4: 131,900,461 S289G unknown Het
Stil T C 4: 115,007,283 V127A probably benign Het
Syne1 A T 10: 5,097,483 probably null Het
Tbc1d22a T A 15: 86,311,835 Y336N possibly damaging Het
Tbc1d8 C T 1: 39,406,762 G116E probably damaging Het
Thrb A G 14: 17,826,963 probably benign Het
Tln1 G T 4: 43,534,399 H2253Q probably benign Het
Tmem131 A C 1: 36,854,847 N158K possibly damaging Het
Tpr C T 1: 150,403,887 R256C probably damaging Het
Triobp C T 15: 78,973,976 A1259V probably damaging Het
Zfp40 A G 17: 23,176,437 I392T possibly damaging Het
Other mutations in Toporsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Toporsl APN 4 52610172 missense probably benign 0.21
IGL01611:Toporsl APN 4 52610794 missense probably damaging 1.00
IGL02638:Toporsl APN 4 52611624 missense probably benign 0.39
IGL02642:Toporsl APN 4 52611114 missense probably benign 0.09
IGL03410:Toporsl APN 4 52611134 missense probably benign 0.07
torsion UTSW 4 52610489 missense probably damaging 1.00
wound UTSW 4 52612140 missense possibly damaging 0.90
IGL03134:Toporsl UTSW 4 52610281 missense probably damaging 0.97
R0548:Toporsl UTSW 4 52612140 missense possibly damaging 0.90
R1444:Toporsl UTSW 4 52610254 missense probably benign 0.01
R2165:Toporsl UTSW 4 52612072 missense possibly damaging 0.47
R2295:Toporsl UTSW 4 52610176 missense probably damaging 0.99
R3410:Toporsl UTSW 4 52610970 missense probably benign 0.10
R3905:Toporsl UTSW 4 52611750 nonsense probably null
R4719:Toporsl UTSW 4 52611996 missense probably benign 0.21
R4782:Toporsl UTSW 4 52610845 missense probably damaging 1.00
R5642:Toporsl UTSW 4 52611515 nonsense probably null
R5724:Toporsl UTSW 4 52611346 missense probably damaging 1.00
R5728:Toporsl UTSW 4 52611469 missense probably benign
R6433:Toporsl UTSW 4 52611548 missense possibly damaging 0.91
R7023:Toporsl UTSW 4 52611211 missense possibly damaging 0.47
R7292:Toporsl UTSW 4 52611630 missense probably benign 0.14
R7408:Toporsl UTSW 4 52612108 missense probably benign 0.12
R7673:Toporsl UTSW 4 52610679 missense probably damaging 1.00
R7974:Toporsl UTSW 4 52611645 missense probably damaging 1.00
R8156:Toporsl UTSW 4 52609975 start gained probably benign
R8186:Toporsl UTSW 4 52610489 missense probably damaging 1.00
R8744:Toporsl UTSW 4 52611967 missense probably benign 0.01
X0065:Toporsl UTSW 4 52610539 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCAAATCCTGGTGTGTCAG -3'
(R):5'- ATCCCTGAATTCTGCTGTGG -3'

Sequencing Primer
(F):5'- GCAGAGGTCAGAGTAATCTCTCTC -3'
(R):5'- CTGCTGTGGTTTGTGTACCCAC -3'
Posted On2019-06-26