Incidental Mutation 'R7294:Kcnj5'
ID566623
Institutional Source Beutler Lab
Gene Symbol Kcnj5
Ensembl Gene ENSMUSG00000032034
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 5
SynonymsGIRK4, Kir3.4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7294 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location32314707-32344350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 32322749 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 90 (L90R)
Ref Sequence ENSEMBL: ENSMUSP00000034533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034533] [ENSMUST00000214223] [ENSMUST00000216033]
Predicted Effect probably damaging
Transcript: ENSMUST00000034533
AA Change: L90R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034533
Gene: ENSMUSG00000032034
AA Change: L90R

DomainStartEndE-ValueType
Pfam:IRK 54 377 7e-147 PFAM
low complexity region 387 405 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214223
AA Change: L90R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000216033
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. It may associate with two other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit mild resting tachycardias and reduced muscarinic-gated atrial potassium channel responses to pharmacological stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,673,582 Y1216* probably null Het
Abca17 G A 17: 24,321,009 T415M not run Het
Adam1a G T 5: 121,520,005 C408* probably null Het
Adamts9 G A 6: 92,894,289 T603M probably damaging Het
Amdhd1 T C 10: 93,534,439 E179G probably benign Het
Bcan T C 3: 87,995,524 T316A possibly damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
C5ar1 T C 7: 16,249,025 I23M probably benign Het
Cd109 A T 9: 78,712,635 E1386D probably damaging Het
Cdcp1 C T 9: 123,177,921 C587Y probably benign Het
Cdh22 A C 2: 165,142,093 V413G possibly damaging Het
Cfap44 A G 16: 44,404,893 probably benign Het
Col2a1 A G 15: 97,987,287 probably null Het
Col6a3 A T 1: 90,828,283 Y95N probably damaging Het
Dusp13 A G 14: 21,733,714 S178P possibly damaging Het
Fhod3 A G 18: 25,132,980 E1575G probably damaging Het
Gfpt2 C T 11: 49,818,608 R209* probably null Het
Gm12169 T A 11: 46,535,612 I182K probably benign Het
Heg1 T C 16: 33,726,489 S573P probably damaging Het
Hinfp A G 9: 44,299,270 C152R probably damaging Het
Hmgcs2 C T 3: 98,290,895 T38I probably benign Het
Jakmip1 T C 5: 37,117,460 F441L possibly damaging Het
Kpna4 A C 3: 69,092,623 probably null Het
Krt15 T A 11: 100,132,022 I456F possibly damaging Het
Leprotl1 A T 8: 34,138,852 probably null Het
Muc4 A T 16: 32,756,461 T42S possibly damaging Het
Nat6 T G 9: 107,582,983 F26V possibly damaging Het
Nr1h5 T C 3: 102,945,262 T419A probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1259 A C 2: 89,943,724 Y130* probably null Het
Olfr549 T A 7: 102,554,953 I223N probably damaging Het
Pax6 T A 2: 105,684,901 C66* probably null Het
Pde10a A T 17: 8,757,021 N53Y probably benign Het
Pdgfra A G 5: 75,181,651 N711S probably benign Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Scn3a A G 2: 65,472,341 S1254P probably damaging Het
Slc26a1 G T 5: 108,673,832 R80S possibly damaging Het
Slc2a4 T C 11: 69,945,399 D262G probably benign Het
Specc1 T A 11: 62,118,337 S226R probably benign Het
Srsf4 A G 4: 131,900,461 S289G unknown Het
Stil T C 4: 115,007,283 V127A probably benign Het
Syne1 A T 10: 5,097,483 probably null Het
Tbc1d22a T A 15: 86,311,835 Y336N possibly damaging Het
Tbc1d8 C T 1: 39,406,762 G116E probably damaging Het
Thrb A G 14: 17,826,963 probably benign Het
Tln1 G T 4: 43,534,399 H2253Q probably benign Het
Tmem131 A C 1: 36,854,847 N158K possibly damaging Het
Toporsl A C 4: 52,611,903 T599P probably benign Het
Tpr C T 1: 150,403,887 R256C probably damaging Het
Triobp C T 15: 78,973,976 A1259V probably damaging Het
Zfp40 A G 17: 23,176,437 I392T possibly damaging Het
Other mutations in Kcnj5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Kcnj5 APN 9 32322423 missense probably damaging 1.00
IGL01700:Kcnj5 APN 9 32322629 missense probably damaging 1.00
IGL02250:Kcnj5 APN 9 32317756 missense probably damaging 1.00
IGL02683:Kcnj5 APN 9 32317780 missense possibly damaging 0.94
IGL02981:Kcnj5 APN 9 32322581 missense probably damaging 1.00
R0388:Kcnj5 UTSW 9 32317863 missense probably damaging 1.00
R0464:Kcnj5 UTSW 9 32322973 missense possibly damaging 0.87
R0524:Kcnj5 UTSW 9 32322974 missense probably benign 0.16
R1711:Kcnj5 UTSW 9 32322569 missense probably damaging 1.00
R1730:Kcnj5 UTSW 9 32322192 missense probably damaging 1.00
R1783:Kcnj5 UTSW 9 32322192 missense probably damaging 1.00
R2203:Kcnj5 UTSW 9 32322900 missense probably benign 0.43
R2424:Kcnj5 UTSW 9 32322820 missense probably damaging 1.00
R3701:Kcnj5 UTSW 9 32317828 missense possibly damaging 0.95
R4459:Kcnj5 UTSW 9 32322395 missense probably damaging 1.00
R4657:Kcnj5 UTSW 9 32322677 missense probably benign
R5422:Kcnj5 UTSW 9 32317705 missense probably benign 0.00
R6073:Kcnj5 UTSW 9 32317800 missense probably damaging 1.00
R7185:Kcnj5 UTSW 9 32322176 missense probably damaging 1.00
R7289:Kcnj5 UTSW 9 32322749 missense probably damaging 1.00
R7295:Kcnj5 UTSW 9 32322791 missense probably damaging 1.00
R7296:Kcnj5 UTSW 9 32322749 missense probably damaging 1.00
R7450:Kcnj5 UTSW 9 32322195 missense possibly damaging 0.52
R7688:Kcnj5 UTSW 9 32322968 missense probably benign 0.00
R7911:Kcnj5 UTSW 9 32322221 missense probably damaging 1.00
R7992:Kcnj5 UTSW 9 32322221 missense probably damaging 1.00
Z1177:Kcnj5 UTSW 9 32317698 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GACTCTGAAGCCATACCCAATG -3'
(R):5'- AGAAGATTCCCAAACAGGCTCG -3'

Sequencing Primer
(F):5'- ATACCCAATGGTTGTTTCTGTCTCG -3'
(R):5'- AACAGGCTCGGGATTACATC -3'
Posted On2019-06-26