Incidental Mutation 'R7294:Thrb'
ID566635
Institutional Source Beutler Lab
Gene Symbol Thrb
Ensembl Gene ENSMUSG00000021779
Gene Namethyroid hormone receptor beta
Synonymsc-erbAbeta, T3R[b], Nr1a2, T3Rbeta, Thrb1, TR beta, Thrb2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R7294 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location17660261-18038090 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to G at 17826963 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022303] [ENSMUST00000091471] [ENSMUST00000224470] [ENSMUST00000224597]
Predicted Effect probably benign
Transcript: ENSMUST00000022303
SMART Domains Protein: ENSMUSP00000022303
Gene: ENSMUSG00000021779

DomainStartEndE-ValueType
ZnF_C4 104 177 2.88e-36 SMART
low complexity region 188 203 N/A INTRINSIC
HOLI 274 432 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091471
SMART Domains Protein: ENSMUSP00000089053
Gene: ENSMUSG00000021779

DomainStartEndE-ValueType
ZnF_C4 104 177 2.88e-36 SMART
low complexity region 188 203 N/A INTRINSIC
HOLI 274 432 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224470
Predicted Effect probably benign
Transcript: ENSMUST00000224597
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear hormone receptor for triiodothyronine. It is one of the several receptors for thyroid hormone, and has been shown to mediate the biological activities of thyroid hormone. Knockout studies in mice suggest that the different receptors, while having certain extent of redundancy, may mediate different functions of thyroid hormone. Mutations in this gene are known to be a cause of generalized thyroid hormone resistance (GTHR), a syndrome characterized by goiter and high levels of circulating thyroid hormone (T3-T4), with normal or slightly elevated thyroid stimulating hormone (TSH). Several alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit elevated T3, T4, and TSH serum levels, abnormal ear morphology, deafness, and abnormal thyroid morphology. Mice homozygous for allele with point mutations exhibit disruption in thyroid hormone sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,673,582 Y1216* probably null Het
Abca17 G A 17: 24,321,009 T415M not run Het
Adam1a G T 5: 121,520,005 C408* probably null Het
Adamts9 G A 6: 92,894,289 T603M probably damaging Het
Amdhd1 T C 10: 93,534,439 E179G probably benign Het
Bcan T C 3: 87,995,524 T316A possibly damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
C5ar1 T C 7: 16,249,025 I23M probably benign Het
Cd109 A T 9: 78,712,635 E1386D probably damaging Het
Cdcp1 C T 9: 123,177,921 C587Y probably benign Het
Cdh22 A C 2: 165,142,093 V413G possibly damaging Het
Cfap44 A G 16: 44,404,893 probably benign Het
Col2a1 A G 15: 97,987,287 probably null Het
Col6a3 A T 1: 90,828,283 Y95N probably damaging Het
Dusp13 A G 14: 21,733,714 S178P possibly damaging Het
Fhod3 A G 18: 25,132,980 E1575G probably damaging Het
Gfpt2 C T 11: 49,818,608 R209* probably null Het
Gm12169 T A 11: 46,535,612 I182K probably benign Het
Heg1 T C 16: 33,726,489 S573P probably damaging Het
Hinfp A G 9: 44,299,270 C152R probably damaging Het
Hmgcs2 C T 3: 98,290,895 T38I probably benign Het
Jakmip1 T C 5: 37,117,460 F441L possibly damaging Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Kpna4 A C 3: 69,092,623 probably null Het
Krt15 T A 11: 100,132,022 I456F possibly damaging Het
Leprotl1 A T 8: 34,138,852 probably null Het
Muc4 A T 16: 32,756,461 T42S possibly damaging Het
Nat6 T G 9: 107,582,983 F26V possibly damaging Het
Nr1h5 T C 3: 102,945,262 T419A probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1259 A C 2: 89,943,724 Y130* probably null Het
Olfr549 T A 7: 102,554,953 I223N probably damaging Het
Pax6 T A 2: 105,684,901 C66* probably null Het
Pde10a A T 17: 8,757,021 N53Y probably benign Het
Pdgfra A G 5: 75,181,651 N711S probably benign Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Scn3a A G 2: 65,472,341 S1254P probably damaging Het
Slc26a1 G T 5: 108,673,832 R80S possibly damaging Het
Slc2a4 T C 11: 69,945,399 D262G probably benign Het
Specc1 T A 11: 62,118,337 S226R probably benign Het
Srsf4 A G 4: 131,900,461 S289G unknown Het
Stil T C 4: 115,007,283 V127A probably benign Het
Syne1 A T 10: 5,097,483 probably null Het
Tbc1d22a T A 15: 86,311,835 Y336N possibly damaging Het
Tbc1d8 C T 1: 39,406,762 G116E probably damaging Het
Tln1 G T 4: 43,534,399 H2253Q probably benign Het
Tmem131 A C 1: 36,854,847 N158K possibly damaging Het
Toporsl A C 4: 52,611,903 T599P probably benign Het
Tpr C T 1: 150,403,887 R256C probably damaging Het
Triobp C T 15: 78,973,976 A1259V probably damaging Het
Zfp40 A G 17: 23,176,437 I392T possibly damaging Het
Other mutations in Thrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Thrb APN 14 18011056 splice site probably benign
IGL02488:Thrb APN 14 18033455 missense probably damaging 0.98
IGL02598:Thrb APN 14 18008606 missense possibly damaging 0.95
IGL02707:Thrb APN 14 18026721 missense probably benign 0.42
harry UTSW 14 18011145 nonsense probably null
R0479:Thrb UTSW 14 18033643 missense probably damaging 0.99
R0988:Thrb UTSW 14 17981837 intron probably benign
R1257:Thrb UTSW 14 18008642 missense probably damaging 1.00
R1522:Thrb UTSW 14 18002597 missense probably damaging 1.00
R1927:Thrb UTSW 14 18008674 missense probably damaging 1.00
R2100:Thrb UTSW 14 18030393 missense possibly damaging 0.73
R2134:Thrb UTSW 14 18033487 missense probably benign 0.22
R3551:Thrb UTSW 14 17963214 missense probably damaging 0.99
R3888:Thrb UTSW 14 18033551 missense probably damaging 1.00
R3975:Thrb UTSW 14 18033456 missense probably damaging 1.00
R4294:Thrb UTSW 14 18011145 nonsense probably null
R4371:Thrb UTSW 14 18030275 missense probably damaging 1.00
R4454:Thrb UTSW 14 18011187 missense probably damaging 0.97
R4457:Thrb UTSW 14 18011187 missense probably damaging 0.97
R4486:Thrb UTSW 14 17925640 start codon destroyed probably null 0.72
R4961:Thrb UTSW 14 18011076 missense probably benign 0.39
R5184:Thrb UTSW 14 18011181 nonsense probably null
R5609:Thrb UTSW 14 18033526 missense probably benign 0.22
R6023:Thrb UTSW 14 18011209 missense probably damaging 0.98
R6891:Thrb UTSW 14 17981899 missense probably benign
R7288:Thrb UTSW 14 18030186 missense probably damaging 1.00
R7780:Thrb UTSW 14 18008608 missense possibly damaging 0.73
R8098:Thrb UTSW 14 18008645 missense probably damaging 1.00
R8739:Thrb UTSW 14 17963082 missense probably benign 0.04
R8788:Thrb UTSW 14 18002558 missense probably damaging 1.00
Z1177:Thrb UTSW 14 18033433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTAGCCCCTGTTTCCACAAAAC -3'
(R):5'- AATGGCTCTTTTCACCCAGC -3'

Sequencing Primer
(F):5'- CCCTGTTTCCACAAAACTATGTATAG -3'
(R):5'- TTCCCTGAGTAAACTAACCTCATC -3'
Posted On2019-06-26