Incidental Mutation 'R7295:Rad9b'
ID566666
Institutional Source Beutler Lab
Gene Symbol Rad9b
Ensembl Gene ENSMUSG00000038569
Gene NameRAD9 checkpoint clamp component B
SynonymsA630082N15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7295 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location122323223-122354233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122334278 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 246 (F246L)
Ref Sequence ENSEMBL: ENSMUSP00000036177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049009] [ENSMUST00000117263]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049009
AA Change: F246L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036177
Gene: ENSMUSG00000038569
AA Change: F246L

DomainStartEndE-ValueType
Pfam:Rad9 14 271 1.8e-91 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000113868
Gene: ENSMUSG00000038569
AA Change: F190L

DomainStartEndE-ValueType
Pfam:Rad9 14 271 1.1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149600
SMART Domains Protein: ENSMUSP00000120843
Gene: ENSMUSG00000038569

DomainStartEndE-ValueType
Pfam:Rad9 1 85 4.3e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, decreased forebrain and somite cell proliferation, and increased cellular sensitivity to gamma irradiation and mitomycin C. Mice heterozygous for a knock-out allele exhibit reduced embryonic, fetal, and early postnatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Acp7 A T 7: 28,629,530 F75Y possibly damaging Het
Adamts19 T A 18: 58,837,883 Y180N probably damaging Het
Adck1 G T 12: 88,431,045 D150Y probably damaging Het
Alb T A 5: 90,462,834 probably null Het
Baat A T 4: 49,490,275 Y270N probably damaging Het
Bmp7 A T 2: 172,939,897 I58N probably damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
Cbfa2t3 T G 8: 122,638,029 D338A probably benign Het
Ccnd2 A T 6: 127,148,762 C104S possibly damaging Het
Clip1 G T 5: 123,627,356 Q713K probably benign Het
Ddx28 G A 8: 106,010,844 S194L probably benign Het
Dync1h1 T C 12: 110,664,749 probably null Het
Edil3 T A 13: 89,131,783 Y193* probably null Het
Eprs A G 1: 185,418,210 probably null Het
Ercc6l2 T G 13: 63,819,775 I63R probably damaging Het
Fam171a2 T C 11: 102,438,238 E565G possibly damaging Het
Fbn1 T A 2: 125,335,487 D1810V probably damaging Het
Foxj2 T C 6: 122,840,231 S506P probably benign Het
Frmpd1 A G 4: 45,285,700 E1507G probably damaging Het
Gfm1 G A 3: 67,440,181 V258I probably benign Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Gphn T C 12: 78,492,102 V174A probably benign Het
Gtpbp3 C A 8: 71,489,495 S123R possibly damaging Het
Hbs1l T C 10: 21,310,152 V491A probably benign Het
Hist1h2bg T C 13: 23,571,769 S113P probably benign Het
Hoxc12 A G 15: 102,938,375 N234S probably damaging Het
Iltifb A T 10: 118,294,943 L16* probably null Het
Kcnj5 T C 9: 32,322,791 D76G probably damaging Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Lonp1 G T 17: 56,622,495 Q181K possibly damaging Het
Mgst1 A T 6: 138,147,756 I23F probably benign Het
Myocos T C 1: 162,657,118 R41G unknown Het
Myod1 A G 7: 46,378,219 D261G probably benign Het
Nop14 C T 5: 34,639,032 R781Q probably damaging Het
Nsmaf A G 4: 6,438,083 V63A probably benign Het
Ntsr1 A T 2: 180,500,932 H172L probably damaging Het
Olfr731 T C 14: 50,238,616 K90E probably damaging Het
Olfr905 A T 9: 38,473,443 E232V probably benign Het
Pcdha11 T C 18: 37,006,926 V536A probably damaging Het
Pcdha6 T A 18: 36,968,136 N127K probably damaging Het
Prps1l1 T A 12: 34,985,680 C265S probably benign Het
Prune2 A G 19: 17,119,897 S922G probably benign Het
Qpctl A T 7: 19,149,130 M19K probably benign Het
Rad51 C T 2: 119,134,118 T230I possibly damaging Het
Rarb A T 14: 16,508,932 probably null Het
Sdcbp2 T C 2: 151,587,401 S214P possibly damaging Het
Slc22a1 T A 17: 12,657,005 M441L probably benign Het
Slc35f1 G A 10: 53,062,541 V190I probably benign Het
Spon1 A T 7: 114,030,240 Q373L possibly damaging Het
Ssbp2 T A 13: 91,694,003 probably null Het
Sult1e1 T A 5: 87,578,653 R201* probably null Het
Traj32 T A 14: 54,186,149 L16Q Het
Ttc16 T C 2: 32,774,425 I67V probably null Het
Ttn T A 2: 76,726,555 K30035N probably damaging Het
Ttn T A 2: 76,946,129 Y1607F unknown Het
Usp16 G A 16: 87,472,089 R290H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Xpnpep3 A G 15: 81,414,534 H56R probably damaging Het
Zfp592 G T 7: 81,024,322 D345Y probably damaging Het
Zfp931 A T 2: 178,068,031 Y187* probably null Het
Other mutations in Rad9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Rad9b APN 5 122344247 missense probably benign 0.01
IGL02375:Rad9b APN 5 122333342 missense possibly damaging 0.71
R0027:Rad9b UTSW 5 122351723 unclassified probably benign
R0027:Rad9b UTSW 5 122351723 unclassified probably benign
R0103:Rad9b UTSW 5 122331527 missense probably damaging 0.99
R0103:Rad9b UTSW 5 122331527 missense probably damaging 0.99
R0975:Rad9b UTSW 5 122334257 splice site probably null
R2006:Rad9b UTSW 5 122339779 missense possibly damaging 0.74
R2265:Rad9b UTSW 5 122351342 missense probably damaging 0.98
R4818:Rad9b UTSW 5 122339776 missense probably damaging 1.00
R5392:Rad9b UTSW 5 122351578 missense probably damaging 1.00
R6041:Rad9b UTSW 5 122351352 missense probably damaging 0.99
R6109:Rad9b UTSW 5 122344297 missense probably damaging 1.00
R6133:Rad9b UTSW 5 122339768 missense possibly damaging 0.79
R6566:Rad9b UTSW 5 122352567 missense probably damaging 1.00
R6695:Rad9b UTSW 5 122351691 missense probably damaging 1.00
R7299:Rad9b UTSW 5 122352614 missense possibly damaging 0.87
R7301:Rad9b UTSW 5 122352614 missense possibly damaging 0.87
Z1088:Rad9b UTSW 5 122333372 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CACAATGCTATGACATCTTTCAGAC -3'
(R):5'- TACAGTGAGATGTCTTTTGGCC -3'

Sequencing Primer
(F):5'- GCTATGACATCTTTCAGACTTTCAGG -3'
(R):5'- GCCCGGAAGAGTTTGACTTC -3'
Posted On2019-06-26