Incidental Mutation 'R7295:Acp7'
ID566672
Institutional Source Beutler Lab
Gene Symbol Acp7
Ensembl Gene ENSMUSG00000037469
Gene Nameacid phosphatase 7, tartrate resistant
SynonymsPapl, C330005M16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R7295 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location28607634-28631332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28629530 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 75 (F75Y)
Ref Sequence ENSEMBL: ENSMUSP00000045437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040112] [ENSMUST00000159095] [ENSMUST00000159418] [ENSMUST00000159560] [ENSMUST00000162880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040112
AA Change: F75Y

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045437
Gene: ENSMUSG00000037469
AA Change: F75Y

DomainStartEndE-ValueType
Pfam:Pur_ac_phosph_N 90 183 2.2e-19 PFAM
Pfam:Metallophos 192 395 6.4e-27 PFAM
Pfam:Metallophos_C 420 482 4.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159095
AA Change: F17Y

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000159418
AA Change: F17Y

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000159560
AA Change: F17Y

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000162880
AA Change: F75Y

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purple acid phosphatases (PAPs), including PAPL, are a family of binuclear metallohydrolases that have been identified in plants, animals, and fungi (Flanagan et al., 2006 [PubMed 16793224]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Adamts19 T A 18: 58,837,883 Y180N probably damaging Het
Adck1 G T 12: 88,431,045 D150Y probably damaging Het
Alb T A 5: 90,462,834 probably null Het
Baat A T 4: 49,490,275 Y270N probably damaging Het
Bmp7 A T 2: 172,939,897 I58N probably damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
Cbfa2t3 T G 8: 122,638,029 D338A probably benign Het
Ccnd2 A T 6: 127,148,762 C104S possibly damaging Het
Clip1 G T 5: 123,627,356 Q713K probably benign Het
Ddx28 G A 8: 106,010,844 S194L probably benign Het
Dync1h1 T C 12: 110,664,749 probably null Het
Edil3 T A 13: 89,131,783 Y193* probably null Het
Eprs A G 1: 185,418,210 probably null Het
Ercc6l2 T G 13: 63,819,775 I63R probably damaging Het
Fam171a2 T C 11: 102,438,238 E565G possibly damaging Het
Fbn1 T A 2: 125,335,487 D1810V probably damaging Het
Foxj2 T C 6: 122,840,231 S506P probably benign Het
Frmpd1 A G 4: 45,285,700 E1507G probably damaging Het
Gfm1 G A 3: 67,440,181 V258I probably benign Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Gphn T C 12: 78,492,102 V174A probably benign Het
Gtpbp3 C A 8: 71,489,495 S123R possibly damaging Het
Hbs1l T C 10: 21,310,152 V491A probably benign Het
Hist1h2bg T C 13: 23,571,769 S113P probably benign Het
Hoxc12 A G 15: 102,938,375 N234S probably damaging Het
Iltifb A T 10: 118,294,943 L16* probably null Het
Kcnj5 T C 9: 32,322,791 D76G probably damaging Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Lonp1 G T 17: 56,622,495 Q181K possibly damaging Het
Mgst1 A T 6: 138,147,756 I23F probably benign Het
Myocos T C 1: 162,657,118 R41G unknown Het
Myod1 A G 7: 46,378,219 D261G probably benign Het
Nop14 C T 5: 34,639,032 R781Q probably damaging Het
Nsmaf A G 4: 6,438,083 V63A probably benign Het
Ntsr1 A T 2: 180,500,932 H172L probably damaging Het
Olfr731 T C 14: 50,238,616 K90E probably damaging Het
Olfr905 A T 9: 38,473,443 E232V probably benign Het
Pcdha11 T C 18: 37,006,926 V536A probably damaging Het
Pcdha6 T A 18: 36,968,136 N127K probably damaging Het
Prps1l1 T A 12: 34,985,680 C265S probably benign Het
Prune2 A G 19: 17,119,897 S922G probably benign Het
Qpctl A T 7: 19,149,130 M19K probably benign Het
Rad51 C T 2: 119,134,118 T230I possibly damaging Het
Rad9b A G 5: 122,334,278 F246L possibly damaging Het
Rarb A T 14: 16,508,932 probably null Het
Sdcbp2 T C 2: 151,587,401 S214P possibly damaging Het
Slc22a1 T A 17: 12,657,005 M441L probably benign Het
Slc35f1 G A 10: 53,062,541 V190I probably benign Het
Spon1 A T 7: 114,030,240 Q373L possibly damaging Het
Ssbp2 T A 13: 91,694,003 probably null Het
Sult1e1 T A 5: 87,578,653 R201* probably null Het
Traj32 T A 14: 54,186,149 L16Q Het
Ttc16 T C 2: 32,774,425 I67V probably null Het
Ttn T A 2: 76,726,555 K30035N probably damaging Het
Ttn T A 2: 76,946,129 Y1607F unknown Het
Usp16 G A 16: 87,472,089 R290H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Xpnpep3 A G 15: 81,414,534 H56R probably damaging Het
Zfp592 G T 7: 81,024,322 D345Y probably damaging Het
Zfp931 A T 2: 178,068,031 Y187* probably null Het
Other mutations in Acp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acp7 APN 7 28614697 missense possibly damaging 0.79
IGL00808:Acp7 APN 7 28614952 missense probably damaging 1.00
IGL01085:Acp7 APN 7 28611053 missense probably damaging 1.00
IGL02123:Acp7 APN 7 28629489 missense probably benign
IGL02250:Acp7 APN 7 28629710 splice site probably benign
IGL02255:Acp7 APN 7 28614723 missense probably damaging 1.00
IGL02904:Acp7 APN 7 28608003 missense probably benign 0.11
IGL03110:Acp7 APN 7 28611039 missense probably benign 0.25
R0172:Acp7 UTSW 7 28615124 missense possibly damaging 0.95
R0360:Acp7 UTSW 7 28611128 splice site probably benign
R0364:Acp7 UTSW 7 28611128 splice site probably benign
R1616:Acp7 UTSW 7 28611078 missense probably damaging 1.00
R1973:Acp7 UTSW 7 28607989 missense probably damaging 1.00
R2077:Acp7 UTSW 7 28629482 missense probably damaging 1.00
R2125:Acp7 UTSW 7 28629549 missense probably damaging 0.99
R2256:Acp7 UTSW 7 28614413 missense probably damaging 0.98
R2257:Acp7 UTSW 7 28614413 missense probably damaging 0.98
R2696:Acp7 UTSW 7 28614576 missense probably benign 0.00
R3103:Acp7 UTSW 7 28610984 critical splice donor site probably null
R3753:Acp7 UTSW 7 28616660 missense probably damaging 1.00
R3833:Acp7 UTSW 7 28615094 missense probably benign 0.00
R4622:Acp7 UTSW 7 28614397 missense probably damaging 1.00
R4849:Acp7 UTSW 7 28615452 missense possibly damaging 0.82
R5364:Acp7 UTSW 7 28611023 missense probably benign 0.25
R5382:Acp7 UTSW 7 28615419 missense possibly damaging 0.80
R5665:Acp7 UTSW 7 28616543 missense probably benign 0.31
R5688:Acp7 UTSW 7 28616495 missense probably benign 0.20
R7278:Acp7 UTSW 7 28630882 missense unknown
R7384:Acp7 UTSW 7 28615088 missense possibly damaging 0.89
R7875:Acp7 UTSW 7 28614727 missense probably damaging 1.00
R7958:Acp7 UTSW 7 28614727 missense probably damaging 1.00
RF006:Acp7 UTSW 7 28614779 missense possibly damaging 0.94
X0018:Acp7 UTSW 7 28607981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATCCCATTTCACAGAGGC -3'
(R):5'- ACAGACATCCTGACAGACGG -3'

Sequencing Primer
(F):5'- CACACCACTGAGGCTGGAAG -3'
(R):5'- CTGACAGACGGACACACGG -3'
Posted On2019-06-26