Incidental Mutation 'R7295:Spon1'
ID 566675
Institutional Source Beutler Lab
Gene Symbol Spon1
Ensembl Gene ENSMUSG00000038156
Gene Name spondin 1, (f-spondin) extracellular matrix protein
Synonyms FSP, D330035F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock # R7295 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 113765998-114043370 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 114030240 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 373 (Q373L)
Ref Sequence ENSEMBL: ENSMUSP00000041157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046687]
AlphaFold Q8VCC9
Predicted Effect possibly damaging
Transcript: ENSMUST00000046687
AA Change: Q373L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041157
Gene: ENSMUSG00000038156
AA Change: Q373L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Reeler 44 172 1e-24 PFAM
Pfam:Spond_N 205 399 7.5e-74 PFAM
low complexity region 431 442 N/A INTRINSIC
TSP1 445 495 7.92e-8 SMART
TSP1 504 555 6.57e-14 SMART
TSP1 561 611 2.29e-13 SMART
TSP1 617 666 1.45e-15 SMART
TSP1 671 721 1.21e-12 SMART
low complexity region 730 747 N/A INTRINSIC
TSP1 757 806 3.12e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased trabecular and cortical bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Acp7 A T 7: 28,629,530 F75Y possibly damaging Het
Adamts19 T A 18: 58,837,883 Y180N probably damaging Het
Adck1 G T 12: 88,431,045 D150Y probably damaging Het
Alb T A 5: 90,462,834 probably null Het
Baat A T 4: 49,490,275 Y270N probably damaging Het
Bmp7 A T 2: 172,939,897 I58N probably damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
Cbfa2t3 T G 8: 122,638,029 D338A probably benign Het
Ccnd2 A T 6: 127,148,762 C104S possibly damaging Het
Clip1 G T 5: 123,627,356 Q713K probably benign Het
Ddx28 G A 8: 106,010,844 S194L probably benign Het
Dync1h1 T C 12: 110,664,749 probably null Het
Edil3 T A 13: 89,131,783 Y193* probably null Het
Eprs A G 1: 185,418,210 probably null Het
Ercc6l2 T G 13: 63,819,775 I63R probably damaging Het
Fam171a2 T C 11: 102,438,238 E565G possibly damaging Het
Fbn1 T A 2: 125,335,487 D1810V probably damaging Het
Foxj2 T C 6: 122,840,231 S506P probably benign Het
Frmpd1 A G 4: 45,285,700 E1507G probably damaging Het
Gfm1 G A 3: 67,440,181 V258I probably benign Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Gphn T C 12: 78,492,102 V174A probably benign Het
Gtpbp3 C A 8: 71,489,495 S123R possibly damaging Het
Hbs1l T C 10: 21,310,152 V491A probably benign Het
Hist1h2bg T C 13: 23,571,769 S113P probably benign Het
Hoxc12 A G 15: 102,938,375 N234S probably damaging Het
Iltifb A T 10: 118,294,943 L16* probably null Het
Kcnj5 T C 9: 32,322,791 D76G probably damaging Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Lonp1 G T 17: 56,622,495 Q181K possibly damaging Het
Mgst1 A T 6: 138,147,756 I23F probably benign Het
Myocos T C 1: 162,657,118 R41G unknown Het
Myod1 A G 7: 46,378,219 D261G probably benign Het
Nop14 C T 5: 34,639,032 R781Q probably damaging Het
Nsmaf A G 4: 6,438,083 V63A probably benign Het
Ntsr1 A T 2: 180,500,932 H172L probably damaging Het
Olfr731 T C 14: 50,238,616 K90E probably damaging Het
Olfr905 A T 9: 38,473,443 E232V probably benign Het
Pcdha11 T C 18: 37,006,926 V536A probably damaging Het
Pcdha6 T A 18: 36,968,136 N127K probably damaging Het
Prps1l1 T A 12: 34,985,680 C265S probably benign Het
Prune2 A G 19: 17,119,897 S922G probably benign Het
Qpctl A T 7: 19,149,130 M19K probably benign Het
Rad51 C T 2: 119,134,118 T230I possibly damaging Het
Rad9b A G 5: 122,334,278 F246L possibly damaging Het
Rarb A T 14: 16,508,932 probably null Het
Sdcbp2 T C 2: 151,587,401 S214P possibly damaging Het
Slc22a1 T A 17: 12,657,005 M441L probably benign Het
Slc35f1 G A 10: 53,062,541 V190I probably benign Het
Ssbp2 T A 13: 91,694,003 probably null Het
Sult1e1 T A 5: 87,578,653 R201* probably null Het
Traj32 T A 14: 54,186,149 L16Q Het
Ttc16 T C 2: 32,774,425 I67V probably null Het
Ttn T A 2: 76,726,555 K30035N probably damaging Het
Ttn T A 2: 76,946,129 Y1607F unknown Het
Usp16 G A 16: 87,472,089 R290H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Xpnpep3 A G 15: 81,414,534 H56R probably damaging Het
Zfp592 G T 7: 81,024,322 D345Y probably damaging Het
Zfp931 A T 2: 178,068,031 Y187* probably null Het
Other mutations in Spon1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Spon1 APN 7 114034290 missense probably damaging 1.00
IGL02385:Spon1 APN 7 113766330 start codon destroyed probably null 0.56
IGL02496:Spon1 APN 7 114036662 missense probably benign 0.00
IGL02562:Spon1 APN 7 114036761 missense probably benign 0.12
IGL03063:Spon1 APN 7 114033025 missense possibly damaging 0.85
IGL03153:Spon1 APN 7 114030344 missense probably damaging 1.00
IGL03392:Spon1 APN 7 114034287 missense probably damaging 0.99
Rust UTSW 7 114016791 missense possibly damaging 0.77
Wilt UTSW 7 113766384 missense probably damaging 0.98
R0512:Spon1 UTSW 7 113836833 missense possibly damaging 0.59
R0646:Spon1 UTSW 7 114039821 missense probably benign 0.04
R1194:Spon1 UTSW 7 113886798 missense probably benign
R1832:Spon1 UTSW 7 114016785 missense probably benign 0.26
R2391:Spon1 UTSW 7 113886847 missense probably damaging 1.00
R3747:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3747:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3749:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3749:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3750:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3750:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R4666:Spon1 UTSW 7 114028969 missense probably benign 0.20
R4730:Spon1 UTSW 7 114033071 missense possibly damaging 0.92
R4774:Spon1 UTSW 7 114039867 missense probably damaging 0.99
R5855:Spon1 UTSW 7 114029072 missense probably damaging 0.99
R5870:Spon1 UTSW 7 114031786 missense probably damaging 1.00
R5914:Spon1 UTSW 7 114030821 missense probably damaging 1.00
R6523:Spon1 UTSW 7 113886785 missense probably benign 0.00
R7138:Spon1 UTSW 7 114036710 missense probably damaging 1.00
R7844:Spon1 UTSW 7 114030332 missense probably benign 0.01
R8064:Spon1 UTSW 7 114036621 missense probably damaging 1.00
R8075:Spon1 UTSW 7 114016793 critical splice donor site probably null
R8927:Spon1 UTSW 7 114030357 critical splice donor site probably null
R8928:Spon1 UTSW 7 114030357 critical splice donor site probably null
R9278:Spon1 UTSW 7 114028953 missense probably damaging 1.00
Z1088:Spon1 UTSW 7 113766386 missense possibly damaging 0.83
Z1176:Spon1 UTSW 7 113927794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTCCATGTTTGATGCCC -3'
(R):5'- TTTTATGCTTGGGCCCTCAG -3'

Sequencing Primer
(F):5'- CCATGTTTGATGCCCAGAAC -3'
(R):5'- TCAGGAGGCCCAGAAATCC -3'
Posted On 2019-06-26