Incidental Mutation 'R7295:Kcnj5'
ID566679
Institutional Source Beutler Lab
Gene Symbol Kcnj5
Ensembl Gene ENSMUSG00000032034
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 5
SynonymsGIRK4, Kir3.4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7295 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location32314707-32344350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32322791 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 76 (D76G)
Ref Sequence ENSEMBL: ENSMUSP00000034533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034533] [ENSMUST00000214223] [ENSMUST00000216033]
Predicted Effect probably damaging
Transcript: ENSMUST00000034533
AA Change: D76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034533
Gene: ENSMUSG00000032034
AA Change: D76G

DomainStartEndE-ValueType
Pfam:IRK 54 377 7e-147 PFAM
low complexity region 387 405 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214223
AA Change: D76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216033
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. It may associate with two other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit mild resting tachycardias and reduced muscarinic-gated atrial potassium channel responses to pharmacological stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Acp7 A T 7: 28,629,530 F75Y possibly damaging Het
Adamts19 T A 18: 58,837,883 Y180N probably damaging Het
Adck1 G T 12: 88,431,045 D150Y probably damaging Het
Alb T A 5: 90,462,834 probably null Het
Baat A T 4: 49,490,275 Y270N probably damaging Het
Bmp7 A T 2: 172,939,897 I58N probably damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
Cbfa2t3 T G 8: 122,638,029 D338A probably benign Het
Ccnd2 A T 6: 127,148,762 C104S possibly damaging Het
Clip1 G T 5: 123,627,356 Q713K probably benign Het
Ddx28 G A 8: 106,010,844 S194L probably benign Het
Dync1h1 T C 12: 110,664,749 probably null Het
Edil3 T A 13: 89,131,783 Y193* probably null Het
Eprs A G 1: 185,418,210 probably null Het
Ercc6l2 T G 13: 63,819,775 I63R probably damaging Het
Fam171a2 T C 11: 102,438,238 E565G possibly damaging Het
Fbn1 T A 2: 125,335,487 D1810V probably damaging Het
Foxj2 T C 6: 122,840,231 S506P probably benign Het
Frmpd1 A G 4: 45,285,700 E1507G probably damaging Het
Gfm1 G A 3: 67,440,181 V258I probably benign Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Gphn T C 12: 78,492,102 V174A probably benign Het
Gtpbp3 C A 8: 71,489,495 S123R possibly damaging Het
Hbs1l T C 10: 21,310,152 V491A probably benign Het
Hist1h2bg T C 13: 23,571,769 S113P probably benign Het
Hoxc12 A G 15: 102,938,375 N234S probably damaging Het
Iltifb A T 10: 118,294,943 L16* probably null Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Lonp1 G T 17: 56,622,495 Q181K possibly damaging Het
Mgst1 A T 6: 138,147,756 I23F probably benign Het
Myocos T C 1: 162,657,118 R41G unknown Het
Myod1 A G 7: 46,378,219 D261G probably benign Het
Nop14 C T 5: 34,639,032 R781Q probably damaging Het
Nsmaf A G 4: 6,438,083 V63A probably benign Het
Ntsr1 A T 2: 180,500,932 H172L probably damaging Het
Olfr731 T C 14: 50,238,616 K90E probably damaging Het
Olfr905 A T 9: 38,473,443 E232V probably benign Het
Pcdha11 T C 18: 37,006,926 V536A probably damaging Het
Pcdha6 T A 18: 36,968,136 N127K probably damaging Het
Prps1l1 T A 12: 34,985,680 C265S probably benign Het
Prune2 A G 19: 17,119,897 S922G probably benign Het
Qpctl A T 7: 19,149,130 M19K probably benign Het
Rad51 C T 2: 119,134,118 T230I possibly damaging Het
Rad9b A G 5: 122,334,278 F246L possibly damaging Het
Rarb A T 14: 16,508,932 probably null Het
Sdcbp2 T C 2: 151,587,401 S214P possibly damaging Het
Slc22a1 T A 17: 12,657,005 M441L probably benign Het
Slc35f1 G A 10: 53,062,541 V190I probably benign Het
Spon1 A T 7: 114,030,240 Q373L possibly damaging Het
Ssbp2 T A 13: 91,694,003 probably null Het
Sult1e1 T A 5: 87,578,653 R201* probably null Het
Traj32 T A 14: 54,186,149 L16Q Het
Ttc16 T C 2: 32,774,425 I67V probably null Het
Ttn T A 2: 76,726,555 K30035N probably damaging Het
Ttn T A 2: 76,946,129 Y1607F unknown Het
Usp16 G A 16: 87,472,089 R290H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Xpnpep3 A G 15: 81,414,534 H56R probably damaging Het
Zfp592 G T 7: 81,024,322 D345Y probably damaging Het
Zfp931 A T 2: 178,068,031 Y187* probably null Het
Other mutations in Kcnj5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Kcnj5 APN 9 32322423 missense probably damaging 1.00
IGL01700:Kcnj5 APN 9 32322629 missense probably damaging 1.00
IGL02250:Kcnj5 APN 9 32317756 missense probably damaging 1.00
IGL02683:Kcnj5 APN 9 32317780 missense possibly damaging 0.94
IGL02981:Kcnj5 APN 9 32322581 missense probably damaging 1.00
R0388:Kcnj5 UTSW 9 32317863 missense probably damaging 1.00
R0464:Kcnj5 UTSW 9 32322973 missense possibly damaging 0.87
R0524:Kcnj5 UTSW 9 32322974 missense probably benign 0.16
R1711:Kcnj5 UTSW 9 32322569 missense probably damaging 1.00
R1730:Kcnj5 UTSW 9 32322192 missense probably damaging 1.00
R1783:Kcnj5 UTSW 9 32322192 missense probably damaging 1.00
R2203:Kcnj5 UTSW 9 32322900 missense probably benign 0.43
R2424:Kcnj5 UTSW 9 32322820 missense probably damaging 1.00
R3701:Kcnj5 UTSW 9 32317828 missense possibly damaging 0.95
R4459:Kcnj5 UTSW 9 32322395 missense probably damaging 1.00
R4657:Kcnj5 UTSW 9 32322677 missense probably benign
R5422:Kcnj5 UTSW 9 32317705 missense probably benign 0.00
R6073:Kcnj5 UTSW 9 32317800 missense probably damaging 1.00
R7185:Kcnj5 UTSW 9 32322176 missense probably damaging 1.00
R7289:Kcnj5 UTSW 9 32322749 missense probably damaging 1.00
R7294:Kcnj5 UTSW 9 32322749 missense probably damaging 1.00
R7296:Kcnj5 UTSW 9 32322749 missense probably damaging 1.00
R7450:Kcnj5 UTSW 9 32322195 missense possibly damaging 0.52
R7688:Kcnj5 UTSW 9 32322968 missense probably benign 0.00
R7911:Kcnj5 UTSW 9 32322221 missense probably damaging 1.00
R7992:Kcnj5 UTSW 9 32322221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTAAGGTTTTCAACACAAGG -3'
(R):5'- GGCCGGTGATTCTAGGAATG -3'

Sequencing Primer
(F):5'- AAGGGATCCACTCTTGGTCAC -3'
(R):5'- CATGGAGATAGGAGTCACTTCCC -3'
Posted On2019-06-26