Incidental Mutation 'R7295:Slc35f1'
ID566682
Institutional Source Beutler Lab
Gene Symbol Slc35f1
Ensembl Gene ENSMUSG00000038602
Gene Namesolute carrier family 35, member F1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7295 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location52690533-53111622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53062541 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 190 (V190I)
Ref Sequence ENSEMBL: ENSMUSP00000101113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105473]
Predicted Effect probably benign
Transcript: ENSMUST00000105473
AA Change: V190I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101113
Gene: ENSMUSG00000038602
AA Change: V190I

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:SLC35F 56 355 1.4e-151 PFAM
Pfam:CRT-like 66 315 2.3e-13 PFAM
Pfam:EamA 217 355 1.7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Acp7 A T 7: 28,629,530 F75Y possibly damaging Het
Adamts19 T A 18: 58,837,883 Y180N probably damaging Het
Adck1 G T 12: 88,431,045 D150Y probably damaging Het
Alb T A 5: 90,462,834 probably null Het
Baat A T 4: 49,490,275 Y270N probably damaging Het
Bmp7 A T 2: 172,939,897 I58N probably damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
Cbfa2t3 T G 8: 122,638,029 D338A probably benign Het
Ccnd2 A T 6: 127,148,762 C104S possibly damaging Het
Clip1 G T 5: 123,627,356 Q713K probably benign Het
Ddx28 G A 8: 106,010,844 S194L probably benign Het
Dync1h1 T C 12: 110,664,749 probably null Het
Edil3 T A 13: 89,131,783 Y193* probably null Het
Eprs A G 1: 185,418,210 probably null Het
Ercc6l2 T G 13: 63,819,775 I63R probably damaging Het
Fam171a2 T C 11: 102,438,238 E565G possibly damaging Het
Fbn1 T A 2: 125,335,487 D1810V probably damaging Het
Foxj2 T C 6: 122,840,231 S506P probably benign Het
Frmpd1 A G 4: 45,285,700 E1507G probably damaging Het
Gfm1 G A 3: 67,440,181 V258I probably benign Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Gphn T C 12: 78,492,102 V174A probably benign Het
Gtpbp3 C A 8: 71,489,495 S123R possibly damaging Het
Hbs1l T C 10: 21,310,152 V491A probably benign Het
Hist1h2bg T C 13: 23,571,769 S113P probably benign Het
Hoxc12 A G 15: 102,938,375 N234S probably damaging Het
Iltifb A T 10: 118,294,943 L16* probably null Het
Kcnj5 T C 9: 32,322,791 D76G probably damaging Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Lonp1 G T 17: 56,622,495 Q181K possibly damaging Het
Mgst1 A T 6: 138,147,756 I23F probably benign Het
Myocos T C 1: 162,657,118 R41G unknown Het
Myod1 A G 7: 46,378,219 D261G probably benign Het
Nop14 C T 5: 34,639,032 R781Q probably damaging Het
Nsmaf A G 4: 6,438,083 V63A probably benign Het
Ntsr1 A T 2: 180,500,932 H172L probably damaging Het
Olfr731 T C 14: 50,238,616 K90E probably damaging Het
Olfr905 A T 9: 38,473,443 E232V probably benign Het
Pcdha11 T C 18: 37,006,926 V536A probably damaging Het
Pcdha6 T A 18: 36,968,136 N127K probably damaging Het
Prps1l1 T A 12: 34,985,680 C265S probably benign Het
Prune2 A G 19: 17,119,897 S922G probably benign Het
Qpctl A T 7: 19,149,130 M19K probably benign Het
Rad51 C T 2: 119,134,118 T230I possibly damaging Het
Rad9b A G 5: 122,334,278 F246L possibly damaging Het
Rarb A T 14: 16,508,932 probably null Het
Sdcbp2 T C 2: 151,587,401 S214P possibly damaging Het
Slc22a1 T A 17: 12,657,005 M441L probably benign Het
Spon1 A T 7: 114,030,240 Q373L possibly damaging Het
Ssbp2 T A 13: 91,694,003 probably null Het
Sult1e1 T A 5: 87,578,653 R201* probably null Het
Traj32 T A 14: 54,186,149 L16Q Het
Ttc16 T C 2: 32,774,425 I67V probably null Het
Ttn T A 2: 76,726,555 K30035N probably damaging Het
Ttn T A 2: 76,946,129 Y1607F unknown Het
Usp16 G A 16: 87,472,089 R290H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Xpnpep3 A G 15: 81,414,534 H56R probably damaging Het
Zfp592 G T 7: 81,024,322 D345Y probably damaging Het
Zfp931 A T 2: 178,068,031 Y187* probably null Het
Other mutations in Slc35f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Slc35f1 APN 10 53062452 missense probably damaging 1.00
IGL01073:Slc35f1 APN 10 53021960 missense probably benign 0.16
IGL01433:Slc35f1 APN 10 53073446 splice site probably benign
IGL01566:Slc35f1 APN 10 53089455 missense probably damaging 1.00
IGL02693:Slc35f1 APN 10 52933128 missense probably damaging 1.00
IGL02870:Slc35f1 APN 10 52933207 missense possibly damaging 0.82
IGL03082:Slc35f1 APN 10 52933138 missense probably benign
R0884:Slc35f1 UTSW 10 53089347 missense probably damaging 1.00
R1340:Slc35f1 UTSW 10 53089454 missense probably damaging 1.00
R1781:Slc35f1 UTSW 10 53062436 splice site probably null
R1813:Slc35f1 UTSW 10 52933195 missense probably damaging 1.00
R1908:Slc35f1 UTSW 10 53021904 missense possibly damaging 0.84
R2044:Slc35f1 UTSW 10 53089347 missense probably damaging 1.00
R2518:Slc35f1 UTSW 10 53073534 missense probably benign 0.07
R3872:Slc35f1 UTSW 10 53021910 missense possibly damaging 0.87
R3934:Slc35f1 UTSW 10 53108218 missense probably damaging 1.00
R3935:Slc35f1 UTSW 10 53108218 missense probably damaging 1.00
R3936:Slc35f1 UTSW 10 53108218 missense probably damaging 1.00
R4118:Slc35f1 UTSW 10 53089368 missense probably damaging 0.98
R4921:Slc35f1 UTSW 10 53062602 missense probably damaging 0.99
R5116:Slc35f1 UTSW 10 53021895 missense probably benign 0.39
R5378:Slc35f1 UTSW 10 52691061 missense possibly damaging 0.86
R5387:Slc35f1 UTSW 10 53108164 missense probably damaging 1.00
R5500:Slc35f1 UTSW 10 52933222 missense probably damaging 0.99
R5590:Slc35f1 UTSW 10 53108178 missense possibly damaging 0.63
R5743:Slc35f1 UTSW 10 53089450 missense probably benign 0.06
R5916:Slc35f1 UTSW 10 52933221 nonsense probably null
R6985:Slc35f1 UTSW 10 53021911 missense probably benign 0.02
R7068:Slc35f1 UTSW 10 53062500 missense probably damaging 1.00
R7427:Slc35f1 UTSW 10 53089414 missense probably damaging 1.00
R7428:Slc35f1 UTSW 10 53089414 missense probably damaging 1.00
R8334:Slc35f1 UTSW 10 53108148 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCTGAGGGGACTTTGACTGC -3'
(R):5'- GAACCAAGTTCCTAGGAGTCC -3'

Sequencing Primer
(F):5'- GCAAGTACTTTCCCTCGAAAAGCTTG -3'
(R):5'- AGGAGTCCTGTTTCTACCCAAGTG -3'
Posted On2019-06-26