Incidental Mutation 'R7295:Adck1'
ID566688
Institutional Source Beutler Lab
Gene Symbol Adck1
Ensembl Gene ENSMUSG00000021044
Gene NameaarF domain containing kinase 1
Synonyms2610005A10Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028105; MGI:1919363

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7295 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location88360554-88461724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88431045 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 150 (D150Y)
Ref Sequence ENSEMBL: ENSMUSP00000098724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101165] [ENSMUST00000166940] [ENSMUST00000222695]
Predicted Effect probably damaging
Transcript: ENSMUST00000101165
AA Change: D150Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098724
Gene: ENSMUSG00000021044
AA Change: D150Y

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 1.7e-42 PFAM
Pfam:Pkinase 150 348 1.3e-5 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166940
AA Change: D150Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127254
Gene: ENSMUSG00000021044
AA Change: D150Y

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 2.2e-42 PFAM
Pfam:Pkinase 150 357 6.2e-6 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222695
AA Change: D150Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (59/60)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Acp7 A T 7: 28,629,530 F75Y possibly damaging Het
Adamts19 T A 18: 58,837,883 Y180N probably damaging Het
Alb T A 5: 90,462,834 probably null Het
Baat A T 4: 49,490,275 Y270N probably damaging Het
Bmp7 A T 2: 172,939,897 I58N probably damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
Cbfa2t3 T G 8: 122,638,029 D338A probably benign Het
Ccnd2 A T 6: 127,148,762 C104S possibly damaging Het
Clip1 G T 5: 123,627,356 Q713K probably benign Het
Ddx28 G A 8: 106,010,844 S194L probably benign Het
Dync1h1 T C 12: 110,664,749 probably null Het
Edil3 T A 13: 89,131,783 Y193* probably null Het
Eprs A G 1: 185,418,210 probably null Het
Ercc6l2 T G 13: 63,819,775 I63R probably damaging Het
Fam171a2 T C 11: 102,438,238 E565G possibly damaging Het
Fbn1 T A 2: 125,335,487 D1810V probably damaging Het
Foxj2 T C 6: 122,840,231 S506P probably benign Het
Frmpd1 A G 4: 45,285,700 E1507G probably damaging Het
Gfm1 G A 3: 67,440,181 V258I probably benign Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Gphn T C 12: 78,492,102 V174A probably benign Het
Gtpbp3 C A 8: 71,489,495 S123R possibly damaging Het
Hbs1l T C 10: 21,310,152 V491A probably benign Het
Hist1h2bg T C 13: 23,571,769 S113P probably benign Het
Hoxc12 A G 15: 102,938,375 N234S probably damaging Het
Iltifb A T 10: 118,294,943 L16* probably null Het
Kcnj5 T C 9: 32,322,791 D76G probably damaging Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Lonp1 G T 17: 56,622,495 Q181K possibly damaging Het
Mgst1 A T 6: 138,147,756 I23F probably benign Het
Myocos T C 1: 162,657,118 R41G unknown Het
Myod1 A G 7: 46,378,219 D261G probably benign Het
Nop14 C T 5: 34,639,032 R781Q probably damaging Het
Nsmaf A G 4: 6,438,083 V63A probably benign Het
Ntsr1 A T 2: 180,500,932 H172L probably damaging Het
Olfr731 T C 14: 50,238,616 K90E probably damaging Het
Olfr905 A T 9: 38,473,443 E232V probably benign Het
Pcdha11 T C 18: 37,006,926 V536A probably damaging Het
Pcdha6 T A 18: 36,968,136 N127K probably damaging Het
Prps1l1 T A 12: 34,985,680 C265S probably benign Het
Prune2 A G 19: 17,119,897 S922G probably benign Het
Qpctl A T 7: 19,149,130 M19K probably benign Het
Rad51 C T 2: 119,134,118 T230I possibly damaging Het
Rad9b A G 5: 122,334,278 F246L possibly damaging Het
Rarb A T 14: 16,508,932 probably null Het
Sdcbp2 T C 2: 151,587,401 S214P possibly damaging Het
Slc22a1 T A 17: 12,657,005 M441L probably benign Het
Slc35f1 G A 10: 53,062,541 V190I probably benign Het
Spon1 A T 7: 114,030,240 Q373L possibly damaging Het
Ssbp2 T A 13: 91,694,003 probably null Het
Sult1e1 T A 5: 87,578,653 R201* probably null Het
Traj32 T A 14: 54,186,149 L16Q Het
Ttc16 T C 2: 32,774,425 I67V probably null Het
Ttn T A 2: 76,726,555 K30035N probably damaging Het
Ttn T A 2: 76,946,129 Y1607F unknown Het
Usp16 G A 16: 87,472,089 R290H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Xpnpep3 A G 15: 81,414,534 H56R probably damaging Het
Zfp592 G T 7: 81,024,322 D345Y probably damaging Het
Zfp931 A T 2: 178,068,031 Y187* probably null Het
Other mutations in Adck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Adck1 APN 12 88368422 missense probably benign 0.00
IGL00822:Adck1 APN 12 88455516 missense probably damaging 0.99
IGL01370:Adck1 APN 12 88456733 splice site probably benign
IGL01480:Adck1 APN 12 88456865 nonsense probably null
IGL01994:Adck1 APN 12 88431156 missense possibly damaging 0.50
IGL02089:Adck1 APN 12 88446710 missense probably damaging 0.96
IGL03058:Adck1 APN 12 88459130 missense probably benign
IGL03196:Adck1 APN 12 88431115 missense probably damaging 1.00
IGL03307:Adck1 APN 12 88459053 missense possibly damaging 0.94
full-figured UTSW 12 88441117 missense possibly damaging 0.63
0152:Adck1 UTSW 12 88431151 missense probably benign 0.03
R0107:Adck1 UTSW 12 88446656 missense possibly damaging 0.62
R0164:Adck1 UTSW 12 88455510 missense probably damaging 0.99
R0164:Adck1 UTSW 12 88455510 missense probably damaging 0.99
R0179:Adck1 UTSW 12 88459172 missense possibly damaging 0.91
R0505:Adck1 UTSW 12 88371691 splice site probably benign
R0561:Adck1 UTSW 12 88368434 missense possibly damaging 0.49
R0831:Adck1 UTSW 12 88368348 start codon destroyed probably null 1.00
R1005:Adck1 UTSW 12 88402102 missense probably damaging 0.98
R1524:Adck1 UTSW 12 88402084 missense probably damaging 1.00
R2016:Adck1 UTSW 12 88461092 missense probably damaging 1.00
R4438:Adck1 UTSW 12 88431150 nonsense probably null
R4745:Adck1 UTSW 12 88402179 splice site probably null
R4827:Adck1 UTSW 12 88446719 missense probably benign 0.06
R4859:Adck1 UTSW 12 88441095 missense probably benign 0.02
R4885:Adck1 UTSW 12 88441095 missense probably benign 0.02
R4921:Adck1 UTSW 12 88441138 missense probably benign 0.10
R5383:Adck1 UTSW 12 88455603 missense probably benign 0.04
R5958:Adck1 UTSW 12 88459052 missense probably benign 0.33
R6028:Adck1 UTSW 12 88402132 missense probably benign
R6199:Adck1 UTSW 12 88441117 missense possibly damaging 0.63
R6317:Adck1 UTSW 12 88402151 missense probably damaging 1.00
R6616:Adck1 UTSW 12 88461188 missense unknown
R6715:Adck1 UTSW 12 88459080 missense probably damaging 1.00
R6915:Adck1 UTSW 12 88455620 missense probably damaging 1.00
R7387:Adck1 UTSW 12 88461052 missense probably benign
R7520:Adck1 UTSW 12 88459205 critical splice donor site probably null
R7562:Adck1 UTSW 12 88368433 missense possibly damaging 0.77
R7745:Adck1 UTSW 12 88456800 missense probably benign
R7759:Adck1 UTSW 12 88402117 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TCTGCACTCCTGTGTAATCG -3'
(R):5'- TATCTGGGAAGCTGTCTGGC -3'

Sequencing Primer
(F):5'- GTGTAATCGTGTTCTCCATACATG -3'
(R):5'- CTGTCTGGCTCCTGAGGAAAAAC -3'
Posted On2019-06-26