Mutagenetix > Incidental Mutation

Incidental Mutation 'R0636:Cntnap2'

56670

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

038825-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0636 (G1)

Quality Score

189

Status

Validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 47296708 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143528 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060839] [ENSMUST00000114641] [ENSMUST00000199100]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000060839

SMART Domains

Protein: ENSMUSP00000056299
Gene: ENSMUSG00000039419

Domain	Start	End	E-Value	Type
low complexity region	39	49	N/A	INTRINSIC
4.1m	59	77	4.21e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114641

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199100

SMART Domains

Protein: ENSMUSP00000143528
Gene: ENSMUSG00000039419

Domain	Start	End	E-Value	Type
low complexity region	39	49	N/A	INTRINSIC
4.1m	59	77	4.21e-7	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.7%

Validation Efficiency

96% (74/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	T	C	4: 103,231,217	Y264C	probably damaging	Het
8030423J24Rik	T	C	13: 70,884,225	F139L	unknown	Het
Aco1	A	G	4: 40,175,697	E146G	probably damaging	Het
Adam2	T	G	14: 66,034,816	D639A	probably benign	Het
Adh4	G	T	3: 138,428,074	R315L	probably damaging	Het
Adprhl1	T	C	8: 13,248,702	D76G	probably damaging	Het
AF366264	T	C	8: 13,837,870	R74G	probably benign	Het
Akip1	T	C	7: 109,707,519		probably benign	Het
Ap3d1	T	A	10: 80,719,382	K370*	probably null	Het
Arfgef1	C	A	1: 10,199,851	V358L	probably benign	Het
Arpp21	A	T	9: 112,183,498	D85E	probably benign	Het
Azi2	A	T	9: 118,062,057	L383F	probably benign	Het
Bpgm	T	A	6: 34,504,287	D206E	probably benign	Het
Bsn	T	C	9: 108,107,834	D3007G	unknown	Het
Ccdc142	T	G	6: 83,107,198		probably benign	Het
Cep135	T	C	5: 76,615,657	V498A	probably benign	Het
Cntn6	A	T	6: 104,863,148	Q1003L	probably benign	Het
Csf2rb2	G	A	15: 78,291,960	Q139*	probably null	Het
Cyp3a16	A	G	5: 145,463,085	V101A	probably benign	Het
D630045J12Rik	T	C	6: 38,196,778	T152A	probably benign	Het
Def8	G	A	8: 123,454,357	W176*	probably null	Het
Dgkg	A	G	16: 22,579,729		probably benign	Het
Ear10	T	C	14: 43,922,994		probably null	Het
Fbxw2	A	T	2: 34,822,847	Y67*	probably null	Het
Flii	T	A	11: 60,715,552	Y1104F	probably damaging	Het
Gm973	G	A	1: 59,551,144	R270K	probably benign	Het
Gm9833	T	C	3: 10,088,783	L204P	possibly damaging	Het
Gnl3	T	A	14: 31,017,153	K75N	probably damaging	Het
Gpc6	A	T	14: 117,624,493	M274L	probably benign	Het
Ifi47	A	G	11: 49,096,651	E415G	possibly damaging	Het
Ift57	A	G	16: 49,711,896	T130A	probably benign	Het
Itpr2	T	A	6: 146,171,412	D2373V	probably damaging	Het
Kat6a	T	C	8: 22,939,323	S1565P	possibly damaging	Het
Klhl6	A	T	16: 19,948,073		probably benign	Het
Klra2	T	C	6: 131,220,104		probably benign	Het
Lama5	A	G	2: 180,189,331		probably null	Het
Mapk4	A	G	18: 73,930,454	S566P	probably benign	Het
Mindy4	C	A	6: 55,276,585	R480S	possibly damaging	Het
Mterf3	T	C	13: 66,922,753		probably benign	Het
Mtmr2	A	G	9: 13,801,913		probably null	Het
Naip5	T	C	13: 100,219,688	T1140A	probably benign	Het
Nf1	A	G	11: 79,535,703	T1648A	probably damaging	Het
Nlk	A	T	11: 78,695,844	D141E	probably benign	Het
Noxa1	C	A	2: 25,086,094		probably benign	Het
Olfr1279	A	G	2: 111,306,412	N69S	probably benign	Het
Olfr1480	A	T	19: 13,530,249	Y236F	possibly damaging	Het
Olfr476	T	C	7: 107,967,472	V25A	probably benign	Het
Otog	G	A	7: 46,264,228		probably null	Het
Pebp4	T	C	14: 70,048,347		probably benign	Het
Phgdh	G	T	3: 98,333,291	N100K	possibly damaging	Het
Pnisr	T	A	4: 21,873,800		probably benign	Het
Ptpn6	T	C	6: 124,725,279	H346R	probably benign	Het
Rsf1	T	C	7: 97,662,019	V652A	possibly damaging	Het
Rubcn	G	A	16: 32,828,686	H624Y	probably damaging	Het
Setdb2	T	C	14: 59,406,704	N656D	probably benign	Het
Slc22a23	T	C	13: 34,299,093	T268A	probably benign	Het
Slc3a1	A	T	17: 85,032,794	T215S	possibly damaging	Het
Srsf2	A	G	11: 116,852,078	S206P	probably benign	Het
Susd2	T	A	10: 75,639,350	D542V	probably damaging	Het
Svep1	G	A	4: 58,073,121	Q2063*	probably null	Het
Syne2	G	A	12: 75,930,983	V1401M	possibly damaging	Het
Tenm2	A	G	11: 36,943,976	L64P	probably damaging	Het
Tigd2	A	G	6: 59,211,287	T380A	possibly damaging	Het
Trmt12	G	T	15: 58,873,985	V411F	probably damaging	Het
Ubr4	T	C	4: 139,436,302		probably null	Het
Ush2a	G	A	1: 188,822,738	C3571Y	probably benign	Het
Usp8	A	G	2: 126,720,110	M75V	possibly damaging	Het
Vcan	C	T	13: 89,704,706	D712N	probably damaging	Het
Vcan	C	A	13: 89,712,267	R327L	probably damaging	Het
Vps8	A	G	16: 21,434,933	E8G	probably benign	Het
Washc5	T	C	15: 59,359,409	D335G	probably benign	Het
Zbtb39	A	G	10: 127,742,835	N426S	probably benign	Het
Zfp184	T	A	13: 21,949,749	D55E	probably damaging	Het
Zfp882	T	C	8: 71,914,337	V336A	probably benign	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ACACTTATCAGCAGATCAGGGACCA -3'
(R):5'- ctccagccccATTTGTTTTAAATTGCTT -3'

Sequencing Primer
(F):5'- gtagggtgaggtaggggg -3'
(R):5'- AAATTGCTTTTTTCCAGGTGAGTAGC -3'

Posted On

2013-07-11