Incidental Mutation 'R7297:Arhgef4'
ID566706
Institutional Source Beutler Lab
Gene Symbol Arhgef4
Ensembl Gene ENSMUSG00000037509
Gene NameRho guanine nucleotide exchange factor (GEF) 4
Synonyms9330140K16Rik, Asef
MMRRC Submission
Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7297 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location34678188-34813309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34807192 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 207 (D207V)
Ref Sequence ENSEMBL: ENSMUSP00000035980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047664] [ENSMUST00000159021] [ENSMUST00000159747] [ENSMUST00000160855] [ENSMUST00000162599]
Predicted Effect probably damaging
Transcript: ENSMUST00000047664
AA Change: D207V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035980
Gene: ENSMUSG00000037509
AA Change: D207V

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
RhoGEF 82 261 3.86e-56 SMART
PH 294 402 2.33e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159021
SMART Domains Protein: ENSMUSP00000124467
Gene: ENSMUSG00000037509

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
Pfam:RhoGEF 82 190 3.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159747
AA Change: D1578V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: D1578V

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 686 712 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1119 1137 N/A INTRINSIC
low complexity region 1240 1254 N/A INTRINSIC
SH3 1361 1416 3.73e-16 SMART
RhoGEF 1453 1632 3.86e-56 SMART
PH 1665 1773 2.33e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160855
SMART Domains Protein: ENSMUSP00000124207
Gene: ENSMUSG00000037509

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
Pfam:RhoGEF 82 187 1.2e-21 PFAM
low complexity region 194 211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162599
AA Change: D351V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124906
Gene: ENSMUSG00000037509
AA Change: D351V

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
SH3 194 249 3.73e-16 SMART
Pfam:RhoGEF 304 405 1.2e-25 PFAM
PH 438 546 2.33e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Abca6 C T 11: 110,183,026 probably null Het
Adh4 A G 3: 138,429,140 I358M possibly damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Arap3 G A 18: 37,973,563 A1409V possibly damaging Het
Arhgap22 C T 14: 33,271,933 R68* probably null Het
Asb15 A G 6: 24,566,463 T472A probably damaging Het
Ascl1 A T 10: 87,492,464 S209T probably damaging Het
Asxl1 T C 2: 153,397,435 V382A probably benign Het
Atp11a T C 8: 12,806,774 probably null Het
Calu C T 6: 29,356,555 R27* probably null Het
Cdh20 A G 1: 104,970,873 T442A probably benign Het
Chrm3 T A 13: 9,877,833 Q389L probably benign Het
Cntnap1 A G 11: 101,188,634 T1233A probably benign Het
Cwc15 G A 9: 14,510,229 C197Y probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dennd3 C T 15: 73,557,610 T914I probably damaging Het
Dlx3 C A 11: 95,120,450 Y43* probably null Het
Dnah17 A T 11: 118,055,730 probably null Het
Dnah17 A G 11: 118,103,356 F1081S probably damaging Het
Dpp10 G A 1: 123,353,428 Q631* probably null Het
Dsel T A 1: 111,861,776 D343V probably damaging Het
Efcab12 T C 6: 115,811,036 D655G possibly damaging Het
Epha8 T A 4: 136,945,913 I187L probably damaging Het
Exosc10 A G 4: 148,580,377 K781E probably damaging Het
Exosc5 T C 7: 25,666,326 L200P probably benign Het
Faiml T C 9: 99,229,613 E131G probably damaging Het
Gm13723 A T 2: 86,873,636 V29E probably damaging Het
Gm5145 G A 17: 20,570,731 V124I probably benign Het
Grm7 T C 6: 110,646,013 V49A probably benign Het
Gtf2e1 T C 16: 37,536,065 D35G probably damaging Het
Heatr1 C T 13: 12,421,060 Q1160* probably null Het
Herc2 T A 7: 56,136,658 C1584S probably benign Het
Hsd17b3 T C 13: 64,076,351 I88V probably damaging Het
Hspa14 A C 2: 3,498,142 L205R possibly damaging Het
Ifna11 A C 4: 88,820,425 E156A possibly damaging Het
Krt83 T C 15: 101,489,647 D170G probably benign Het
Mas1 T C 17: 12,841,858 Y226C probably damaging Het
Micall1 T C 15: 79,120,897 F190L unknown Het
Msi2 A T 11: 88,480,038 L141Q probably damaging Het
Nfkbib T C 7: 28,766,343 D27G probably benign Het
Nlrp9b A G 7: 20,049,513 D927G possibly damaging Het
Nrg3 T C 14: 38,370,939 D579G probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr26 G A 9: 38,855,949 D296N probably damaging Het
Parp4 C T 14: 56,647,681 P1406S not run Het
Pkib A T 10: 57,736,326 Q101L possibly damaging Het
Plat C T 8: 22,775,697 T252I probably benign Het
Ppm1d A T 11: 85,345,995 E533D probably damaging Het
Psd3 T C 8: 68,121,034 K165R probably damaging Het
Psg29 T A 7: 17,210,691 Y375* probably null Het
Pus7 A T 5: 23,741,910 I644N probably damaging Het
Rbbp9 A T 2: 144,543,802 M181K probably benign Het
Rell1 A T 5: 63,936,075 N112K possibly damaging Het
Simc1 AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG 13: 54,525,235 probably benign Het
Skint5 G A 4: 113,542,934 T1184M unknown Het
Slc27a2 T A 2: 126,578,946 D452E probably damaging Het
Slc44a4 T A 17: 34,927,912 I489N probably damaging Het
Slfn14 T A 11: 83,278,995 K608* probably null Het
Snx15 T A 19: 6,120,507 I301F probably damaging Het
Sost C T 11: 101,964,103 G127R probably damaging Het
Stt3b A G 9: 115,276,957 I150T probably damaging Het
Susd2 T C 10: 75,642,568 D58G probably benign Het
Tex46 T G 4: 136,612,901 V99G probably damaging Het
Tgfbi T A 13: 56,632,113 F492I possibly damaging Het
Tmem132c G A 5: 127,360,217 A257T probably benign Het
Trim2 A T 3: 84,210,233 I51K probably damaging Het
Tsn A T 1: 118,300,861 Y210* probably null Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r5 A T 6: 56,986,219 N293I possibly damaging Het
Vmn2r124 A T 17: 18,073,573 I641F probably damaging Het
Vmn2r84 T C 10: 130,391,250 N240D probably benign Het
Wbp1l A G 19: 46,654,400 D264G possibly damaging Het
Other mutations in Arhgef4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Arhgef4 APN 1 34811696 missense possibly damaging 0.88
IGL02376:Arhgef4 APN 1 34806059 missense probably damaging 1.00
IGL02604:Arhgef4 APN 1 34811723 nonsense probably null
IGL03240:Arhgef4 APN 1 34806026 missense probably benign 0.03
R0095:Arhgef4 UTSW 1 34732370 nonsense probably null
R0157:Arhgef4 UTSW 1 34806394 missense probably damaging 1.00
R0243:Arhgef4 UTSW 1 34806999 intron probably null
R0383:Arhgef4 UTSW 1 34810533 missense probably damaging 1.00
R0440:Arhgef4 UTSW 1 34745448 splice site probably null
R0452:Arhgef4 UTSW 1 34732322 missense probably damaging 0.97
R0893:Arhgef4 UTSW 1 34807110 missense probably damaging 1.00
R1429:Arhgef4 UTSW 1 34810339 missense probably damaging 1.00
R1437:Arhgef4 UTSW 1 34723945 missense unknown
R1669:Arhgef4 UTSW 1 34732158 missense possibly damaging 0.86
R1780:Arhgef4 UTSW 1 34724160 missense possibly damaging 0.73
R1809:Arhgef4 UTSW 1 34810555 critical splice donor site probably null
R1879:Arhgef4 UTSW 1 34722440 missense unknown
R1908:Arhgef4 UTSW 1 34724259 missense probably benign 0.01
R1919:Arhgef4 UTSW 1 34811140 missense probably damaging 0.98
R2020:Arhgef4 UTSW 1 34723810 missense unknown
R2058:Arhgef4 UTSW 1 34722377 missense unknown
R2213:Arhgef4 UTSW 1 34807149 unclassified probably null
R2851:Arhgef4 UTSW 1 34724048 missense unknown
R2852:Arhgef4 UTSW 1 34724048 missense unknown
R2853:Arhgef4 UTSW 1 34724048 missense unknown
R3697:Arhgef4 UTSW 1 34722440 missense unknown
R4012:Arhgef4 UTSW 1 34725106 missense possibly damaging 0.75
R4118:Arhgef4 UTSW 1 34732347 missense probably damaging 0.98
R4133:Arhgef4 UTSW 1 34806104 missense probably damaging 1.00
R4534:Arhgef4 UTSW 1 34723081 missense unknown
R4535:Arhgef4 UTSW 1 34723081 missense unknown
R4581:Arhgef4 UTSW 1 34732124 missense possibly damaging 0.83
R4665:Arhgef4 UTSW 1 34806032 missense possibly damaging 0.89
R4678:Arhgef4 UTSW 1 34722668 missense unknown
R4684:Arhgef4 UTSW 1 34811785 unclassified probably null
R4706:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
R4745:Arhgef4 UTSW 1 34807275 missense probably damaging 1.00
R4747:Arhgef4 UTSW 1 34723274 missense unknown
R4988:Arhgef4 UTSW 1 34723454 missense unknown
R5063:Arhgef4 UTSW 1 34724215 missense probably benign 0.00
R5154:Arhgef4 UTSW 1 34732374 missense probably benign 0.43
R5156:Arhgef4 UTSW 1 34723274 missense unknown
R5263:Arhgef4 UTSW 1 34724997 missense possibly damaging 0.84
R5450:Arhgef4 UTSW 1 34807324 intron probably benign
R5807:Arhgef4 UTSW 1 34807615 intron probably benign
R5863:Arhgef4 UTSW 1 34722845 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6311:Arhgef4 UTSW 1 34723981 missense unknown
R6315:Arhgef4 UTSW 1 34723477 missense unknown
R6316:Arhgef4 UTSW 1 34723477 missense unknown
R6318:Arhgef4 UTSW 1 34723477 missense unknown
R6323:Arhgef4 UTSW 1 34723477 missense unknown
R6324:Arhgef4 UTSW 1 34723477 missense unknown
R6325:Arhgef4 UTSW 1 34723477 missense unknown
R6340:Arhgef4 UTSW 1 34732223 missense probably damaging 1.00
R6835:Arhgef4 UTSW 1 34806493 missense probably damaging 1.00
R6981:Arhgef4 UTSW 1 34722452 missense unknown
R7087:Arhgef4 UTSW 1 34811686 missense probably damaging 0.96
R7525:Arhgef4 UTSW 1 34809704 missense probably damaging 1.00
R7614:Arhgef4 UTSW 1 34732235 missense possibly damaging 0.67
R7693:Arhgef4 UTSW 1 34724141 missense probably benign 0.01
R7892:Arhgef4 UTSW 1 34721804 missense unknown
R7895:Arhgef4 UTSW 1 34806397 missense probably damaging 1.00
R7975:Arhgef4 UTSW 1 34721804 missense unknown
R7978:Arhgef4 UTSW 1 34806397 missense probably damaging 1.00
RF012:Arhgef4 UTSW 1 34724484 small deletion probably benign
X0062:Arhgef4 UTSW 1 34724227 missense probably benign 0.35
YA93:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
Z1176:Arhgef4 UTSW 1 34723729 missense unknown
Z1176:Arhgef4 UTSW 1 34804926 missense probably damaging 1.00
Z1177:Arhgef4 UTSW 1 34722921 missense unknown
Z1177:Arhgef4 UTSW 1 34723366 missense unknown
Z1177:Arhgef4 UTSW 1 34724259 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCAGCGCCTATATAAAATGCG -3'
(R):5'- AAATAACTCAGTGTGCTGGCTG -3'

Sequencing Primer
(F):5'- CTGTTGCCTGGGGAAACAG -3'
(R):5'- CTGATGGCATGCAGTCTCAG -3'
Posted On2019-06-26