Incidental Mutation 'R7297:Dsel'
ID566708
Institutional Source Beutler Lab
Gene Symbol Dsel
Ensembl Gene ENSMUSG00000038702
Gene Namedermatan sulfate epimerase-like
Synonyms9330132E09Rik, DS-epi2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7297 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location111858702-111864918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111861776 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 343 (D343V)
Ref Sequence ENSEMBL: ENSMUSP00000043570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035462]
Predicted Effect probably damaging
Transcript: ENSMUST00000035462
AA Change: D343V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043570
Gene: ENSMUSG00000038702
AA Change: D343V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 120 131 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
transmembrane domain 769 791 N/A INTRINSIC
transmembrane domain 798 817 N/A INTRINSIC
Pfam:Sulfotransfer_1 847 1201 2.1e-12 PFAM
Pfam:Sulfotransfer_3 848 1143 1.7e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced epimerase activity in the skin, lung, liver, spleen, kidney and brain and reduced iduronic acid content in the brain and kidney chondroitin sulfate/dermatan sulfate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Abca6 C T 11: 110,183,026 probably null Het
Adh4 A G 3: 138,429,140 I358M possibly damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Arap3 G A 18: 37,973,563 A1409V possibly damaging Het
Arhgap22 C T 14: 33,271,933 R68* probably null Het
Arhgef4 A T 1: 34,807,192 D207V probably damaging Het
Asb15 A G 6: 24,566,463 T472A probably damaging Het
Ascl1 A T 10: 87,492,464 S209T probably damaging Het
Asxl1 T C 2: 153,397,435 V382A probably benign Het
Atp11a T C 8: 12,806,774 probably null Het
Calu C T 6: 29,356,555 R27* probably null Het
Cdh20 A G 1: 104,970,873 T442A probably benign Het
Chrm3 T A 13: 9,877,833 Q389L probably benign Het
Cntnap1 A G 11: 101,188,634 T1233A probably benign Het
Cwc15 G A 9: 14,510,229 C197Y probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dennd3 C T 15: 73,557,610 T914I probably damaging Het
Dlx3 C A 11: 95,120,450 Y43* probably null Het
Dnah17 A T 11: 118,055,730 probably null Het
Dnah17 A G 11: 118,103,356 F1081S probably damaging Het
Dpp10 G A 1: 123,353,428 Q631* probably null Het
Efcab12 T C 6: 115,811,036 D655G possibly damaging Het
Epha8 T A 4: 136,945,913 I187L probably damaging Het
Exosc10 A G 4: 148,580,377 K781E probably damaging Het
Exosc5 T C 7: 25,666,326 L200P probably benign Het
Faiml T C 9: 99,229,613 E131G probably damaging Het
Gm13723 A T 2: 86,873,636 V29E probably damaging Het
Gm5145 G A 17: 20,570,731 V124I probably benign Het
Grm7 T C 6: 110,646,013 V49A probably benign Het
Gtf2e1 T C 16: 37,536,065 D35G probably damaging Het
Heatr1 C T 13: 12,421,060 Q1160* probably null Het
Herc2 T A 7: 56,136,658 C1584S probably benign Het
Hsd17b3 T C 13: 64,076,351 I88V probably damaging Het
Hspa14 A C 2: 3,498,142 L205R possibly damaging Het
Ifna11 A C 4: 88,820,425 E156A possibly damaging Het
Krt83 T C 15: 101,489,647 D170G probably benign Het
Mas1 T C 17: 12,841,858 Y226C probably damaging Het
Micall1 T C 15: 79,120,897 F190L unknown Het
Msi2 A T 11: 88,480,038 L141Q probably damaging Het
Nfkbib T C 7: 28,766,343 D27G probably benign Het
Nlrp9b A G 7: 20,049,513 D927G possibly damaging Het
Nrg3 T C 14: 38,370,939 D579G probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr26 G A 9: 38,855,949 D296N probably damaging Het
Parp4 C T 14: 56,647,681 P1406S not run Het
Pkib A T 10: 57,736,326 Q101L possibly damaging Het
Plat C T 8: 22,775,697 T252I probably benign Het
Ppm1d A T 11: 85,345,995 E533D probably damaging Het
Psd3 T C 8: 68,121,034 K165R probably damaging Het
Psg29 T A 7: 17,210,691 Y375* probably null Het
Pus7 A T 5: 23,741,910 I644N probably damaging Het
Rbbp9 A T 2: 144,543,802 M181K probably benign Het
Rell1 A T 5: 63,936,075 N112K possibly damaging Het
Simc1 AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG 13: 54,525,235 probably benign Het
Skint5 G A 4: 113,542,934 T1184M unknown Het
Slc27a2 T A 2: 126,578,946 D452E probably damaging Het
Slc44a4 T A 17: 34,927,912 I489N probably damaging Het
Slfn14 T A 11: 83,278,995 K608* probably null Het
Snx15 T A 19: 6,120,507 I301F probably damaging Het
Sost C T 11: 101,964,103 G127R probably damaging Het
Stt3b A G 9: 115,276,957 I150T probably damaging Het
Susd2 T C 10: 75,642,568 D58G probably benign Het
Tex46 T G 4: 136,612,901 V99G probably damaging Het
Tgfbi T A 13: 56,632,113 F492I possibly damaging Het
Tmem132c G A 5: 127,360,217 A257T probably benign Het
Trim2 A T 3: 84,210,233 I51K probably damaging Het
Tsn A T 1: 118,300,861 Y210* probably null Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r5 A T 6: 56,986,219 N293I possibly damaging Het
Vmn2r124 A T 17: 18,073,573 I641F probably damaging Het
Vmn2r84 T C 10: 130,391,250 N240D probably benign Het
Wbp1l A G 19: 46,654,400 D264G possibly damaging Het
Other mutations in Dsel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Dsel APN 1 111860061 nonsense probably null
IGL01562:Dsel APN 1 111860319 missense probably benign
IGL01591:Dsel APN 1 111859695 missense probably benign 0.08
IGL01822:Dsel APN 1 111861896 missense probably damaging 1.00
IGL02289:Dsel APN 1 111860102 nonsense probably null
IGL02557:Dsel APN 1 111862570 missense probably damaging 1.00
IGL02805:Dsel APN 1 111862316 missense probably damaging 1.00
IGL02864:Dsel APN 1 111859214 missense probably damaging 1.00
IGL02887:Dsel APN 1 111860732 missense possibly damaging 0.90
IGL03092:Dsel APN 1 111860063 missense probably damaging 1.00
IGL03117:Dsel APN 1 111859178 utr 3 prime probably benign
IGL03182:Dsel APN 1 111860138 missense probably damaging 0.99
rudolph UTSW 1 111859817 missense probably damaging 0.99
R0196:Dsel UTSW 1 111861603 missense possibly damaging 0.86
R0465:Dsel UTSW 1 111862262 missense probably benign 0.00
R0725:Dsel UTSW 1 111859952 missense possibly damaging 0.79
R1024:Dsel UTSW 1 111860673 missense probably damaging 1.00
R1147:Dsel UTSW 1 111862209 missense possibly damaging 0.71
R1147:Dsel UTSW 1 111862209 missense possibly damaging 0.71
R1654:Dsel UTSW 1 111862512 missense probably damaging 1.00
R1728:Dsel UTSW 1 111859457 missense probably benign
R1728:Dsel UTSW 1 111859994 missense probably benign
R1729:Dsel UTSW 1 111859457 missense probably benign
R1729:Dsel UTSW 1 111859994 missense probably benign
R1730:Dsel UTSW 1 111859457 missense probably benign
R1730:Dsel UTSW 1 111859994 missense probably benign
R1735:Dsel UTSW 1 111860915 missense probably damaging 1.00
R1739:Dsel UTSW 1 111859457 missense probably benign
R1739:Dsel UTSW 1 111859994 missense probably benign
R1762:Dsel UTSW 1 111859457 missense probably benign
R1762:Dsel UTSW 1 111859994 missense probably benign
R1783:Dsel UTSW 1 111859457 missense probably benign
R1783:Dsel UTSW 1 111859994 missense probably benign
R1785:Dsel UTSW 1 111859457 missense probably benign
R1785:Dsel UTSW 1 111859994 missense probably benign
R2049:Dsel UTSW 1 111859457 missense probably benign
R2080:Dsel UTSW 1 111859962 missense probably benign
R2141:Dsel UTSW 1 111859457 missense probably benign
R2142:Dsel UTSW 1 111859457 missense probably benign
R2150:Dsel UTSW 1 111860257 missense probably benign 0.04
R4324:Dsel UTSW 1 111861393 missense probably damaging 1.00
R5378:Dsel UTSW 1 111862821 start gained probably benign
R5881:Dsel UTSW 1 111859438 missense probably damaging 1.00
R5919:Dsel UTSW 1 111860253 missense probably benign
R6820:Dsel UTSW 1 111859817 missense probably damaging 0.99
R7003:Dsel UTSW 1 111860295 missense probably benign
R7064:Dsel UTSW 1 111862847 start gained probably benign
R7340:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7341:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7343:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7346:Dsel UTSW 1 111861068 missense probably damaging 1.00
R7347:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7365:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7366:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7367:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7393:Dsel UTSW 1 111861573 missense probably damaging 1.00
X0057:Dsel UTSW 1 111859210 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCAAAATCAACAGGAGGCTG -3'
(R):5'- CATTGGATGAAGGTGTGGCC -3'

Sequencing Primer
(F):5'- TCAACAGGAGGCTGTGGGG -3'
(R):5'- GTGGCCTATGGAAGCTATACCTC -3'
Posted On2019-06-26