Incidental Mutation 'R7297:Tsn'
ID566709
Institutional Source Beutler Lab
Gene Symbol Tsn
Ensembl Gene ENSMUSG00000026374
Gene Nametranslin
SynonymsTB-RBP, 2610034C24Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #R7297 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location118294778-118311739 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 118300861 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 210 (Y210*)
Ref Sequence ENSEMBL: ENSMUSP00000027623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027623]
PDB Structure
Crystal Structure of Mouse Testis/Brain RNA-binding Protein (TB-RBP) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000027623
AA Change: Y210*
SMART Domains Protein: ENSMUSP00000027623
Gene: ENSMUSG00000026374
AA Change: Y210*

DomainStartEndE-ValueType
Pfam:Translin 19 216 1.8e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein which specifically recognizes conserved target sequences at the breakpoint junction of chromosomal translocations. Translin polypeptides form a multimeric structure that is responsible for its DNA-binding activity. Recombination-associated motifs and translin-binding sites are present at recombination hotspots and may serve as indicators of breakpoints in genes which are fused by translocations. These binding activities may play a crucial role in chromosomal translocation in lymphoid neoplasms. This protein encoded by this gene, when complexed with translin-associated protein X, also forms a Mg ion-dependent endoribonuclease that promotes RNA-induced silencing complex (RISC) activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
PHENOTYPE: Inactivation of this gene results in reduced female fertility, growth defects, and abnormalities related to activity and dexterity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Abca6 C T 11: 110,183,026 probably null Het
Adh4 A G 3: 138,429,140 I358M possibly damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Arap3 G A 18: 37,973,563 A1409V possibly damaging Het
Arhgap22 C T 14: 33,271,933 R68* probably null Het
Arhgef4 A T 1: 34,807,192 D207V probably damaging Het
Asb15 A G 6: 24,566,463 T472A probably damaging Het
Ascl1 A T 10: 87,492,464 S209T probably damaging Het
Asxl1 T C 2: 153,397,435 V382A probably benign Het
Atp11a T C 8: 12,806,774 probably null Het
Calu C T 6: 29,356,555 R27* probably null Het
Cdh20 A G 1: 104,970,873 T442A probably benign Het
Chrm3 T A 13: 9,877,833 Q389L probably benign Het
Cntnap1 A G 11: 101,188,634 T1233A probably benign Het
Cwc15 G A 9: 14,510,229 C197Y probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dennd3 C T 15: 73,557,610 T914I probably damaging Het
Dlx3 C A 11: 95,120,450 Y43* probably null Het
Dnah17 A T 11: 118,055,730 probably null Het
Dnah17 A G 11: 118,103,356 F1081S probably damaging Het
Dpp10 G A 1: 123,353,428 Q631* probably null Het
Dsel T A 1: 111,861,776 D343V probably damaging Het
Efcab12 T C 6: 115,811,036 D655G possibly damaging Het
Epha8 T A 4: 136,945,913 I187L probably damaging Het
Exosc10 A G 4: 148,580,377 K781E probably damaging Het
Exosc5 T C 7: 25,666,326 L200P probably benign Het
Faiml T C 9: 99,229,613 E131G probably damaging Het
Gm13723 A T 2: 86,873,636 V29E probably damaging Het
Gm5145 G A 17: 20,570,731 V124I probably benign Het
Grm7 T C 6: 110,646,013 V49A probably benign Het
Gtf2e1 T C 16: 37,536,065 D35G probably damaging Het
Heatr1 C T 13: 12,421,060 Q1160* probably null Het
Herc2 T A 7: 56,136,658 C1584S probably benign Het
Hsd17b3 T C 13: 64,076,351 I88V probably damaging Het
Hspa14 A C 2: 3,498,142 L205R possibly damaging Het
Ifna11 A C 4: 88,820,425 E156A possibly damaging Het
Krt83 T C 15: 101,489,647 D170G probably benign Het
Mas1 T C 17: 12,841,858 Y226C probably damaging Het
Micall1 T C 15: 79,120,897 F190L unknown Het
Msi2 A T 11: 88,480,038 L141Q probably damaging Het
Nfkbib T C 7: 28,766,343 D27G probably benign Het
Nlrp9b A G 7: 20,049,513 D927G possibly damaging Het
Nrg3 T C 14: 38,370,939 D579G probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr26 G A 9: 38,855,949 D296N probably damaging Het
Parp4 C T 14: 56,647,681 P1406S not run Het
Pkib A T 10: 57,736,326 Q101L possibly damaging Het
Plat C T 8: 22,775,697 T252I probably benign Het
Ppm1d A T 11: 85,345,995 E533D probably damaging Het
Psd3 T C 8: 68,121,034 K165R probably damaging Het
Psg29 T A 7: 17,210,691 Y375* probably null Het
Pus7 A T 5: 23,741,910 I644N probably damaging Het
Rbbp9 A T 2: 144,543,802 M181K probably benign Het
Rell1 A T 5: 63,936,075 N112K possibly damaging Het
Simc1 AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG 13: 54,525,235 probably benign Het
Skint5 G A 4: 113,542,934 T1184M unknown Het
Slc27a2 T A 2: 126,578,946 D452E probably damaging Het
Slc44a4 T A 17: 34,927,912 I489N probably damaging Het
Slfn14 T A 11: 83,278,995 K608* probably null Het
Snx15 T A 19: 6,120,507 I301F probably damaging Het
Sost C T 11: 101,964,103 G127R probably damaging Het
Stt3b A G 9: 115,276,957 I150T probably damaging Het
Susd2 T C 10: 75,642,568 D58G probably benign Het
Tex46 T G 4: 136,612,901 V99G probably damaging Het
Tgfbi T A 13: 56,632,113 F492I possibly damaging Het
Tmem132c G A 5: 127,360,217 A257T probably benign Het
Trim2 A T 3: 84,210,233 I51K probably damaging Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r5 A T 6: 56,986,219 N293I possibly damaging Het
Vmn2r124 A T 17: 18,073,573 I641F probably damaging Het
Vmn2r84 T C 10: 130,391,250 N240D probably benign Het
Wbp1l A G 19: 46,654,400 D264G possibly damaging Het
Other mutations in Tsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02887:Tsn APN 1 118309821 missense probably benign 0.00
IGL03130:Tsn APN 1 118305269 missense possibly damaging 0.62
R0017:Tsn UTSW 1 118300859 missense probably damaging 1.00
R0017:Tsn UTSW 1 118300859 missense probably damaging 1.00
R1751:Tsn UTSW 1 118300888 missense probably damaging 1.00
R1767:Tsn UTSW 1 118300888 missense probably damaging 1.00
R1773:Tsn UTSW 1 118305239 missense probably benign 0.00
R3802:Tsn UTSW 1 118305296 missense probably damaging 1.00
R4398:Tsn UTSW 1 118311069 utr 5 prime probably benign
R5492:Tsn UTSW 1 118304713 missense probably damaging 1.00
R5582:Tsn UTSW 1 118305214 missense probably damaging 0.96
R6247:Tsn UTSW 1 118305209 missense probably benign 0.18
R7691:Tsn UTSW 1 118309775 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGCAAGTGCACTGAAAATCAAC -3'
(R):5'- GCTGTCTGTCAACAGTGTCAC -3'

Sequencing Primer
(F):5'- GTATTTCAATTCTGACACTCACAGC -3'
(R):5'- AGTGTCACTGCTGGAGACTACTC -3'
Posted On2019-06-26