Mutagenetix > Incidental Mutation

Incidental Mutation 'R7297:Dpp10'

566710

Institutional Source

Beutler Lab

Gene Symbol

Dpp10

Ensembl Gene

ENSMUSG00000036815

Gene Name

dipeptidylpeptidase 10

Synonyms

6430601K09Rik, DPRP3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7297 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123321471-124045559 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 123353428 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 631 (Q631*)

Ref Sequence

ENSEMBL: ENSMUSP00000108225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000112603
AA Change: Q620*

SMART Domains

Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: Q620*

Domain	Start	End	E-Value	Type
low complexity region	10	25	N/A	INTRINSIC
Pfam:DPPIV_N	83	450	4.9e-118	PFAM
Pfam:Peptidase_S9	530	734	6.4e-47	PFAM
Pfam:DLH	556	711	1.4e-6	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000112606
AA Change: Q631*

SMART Domains

Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: Q631*

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	64	79	N/A	INTRINSIC
Pfam:DPPIV_N	137	504	4.4e-115	PFAM
Pfam:Peptidase_S9	584	788	8.6e-48	PFAM
Pfam:DLH	604	774	1.1e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	A	G	2: 25,442,076	D1400G	probably benign	Het
Abca6	C	T	11: 110,183,026		probably null	Het
Adh4	A	G	3: 138,429,140	I358M	possibly damaging	Het
Akap6	T	G	12: 52,887,364	D546E	probably benign	Het
Arap3	G	A	18: 37,973,563	A1409V	possibly damaging	Het
Arhgap22	C	T	14: 33,271,933	R68*	probably null	Het
Arhgef4	A	T	1: 34,807,192	D207V	probably damaging	Het
Asb15	A	G	6: 24,566,463	T472A	probably damaging	Het
Ascl1	A	T	10: 87,492,464	S209T	probably damaging	Het
Asxl1	T	C	2: 153,397,435	V382A	probably benign	Het
Atp11a	T	C	8: 12,806,774		probably null	Het
Calu	C	T	6: 29,356,555	R27*	probably null	Het
Cdh20	A	G	1: 104,970,873	T442A	probably benign	Het
Chrm3	T	A	13: 9,877,833	Q389L	probably benign	Het
Cntnap1	A	G	11: 101,188,634	T1233A	probably benign	Het
Cwc15	G	A	9: 14,510,229	C197Y	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dennd3	C	T	15: 73,557,610	T914I	probably damaging	Het
Dlx3	C	A	11: 95,120,450	Y43*	probably null	Het
Dnah17	A	T	11: 118,055,730		probably null	Het
Dnah17	A	G	11: 118,103,356	F1081S	probably damaging	Het
Dsel	T	A	1: 111,861,776	D343V	probably damaging	Het
Efcab12	T	C	6: 115,811,036	D655G	possibly damaging	Het
Epha8	T	A	4: 136,945,913	I187L	probably damaging	Het
Exosc10	A	G	4: 148,580,377	K781E	probably damaging	Het
Exosc5	T	C	7: 25,666,326	L200P	probably benign	Het
Faiml	T	C	9: 99,229,613	E131G	probably damaging	Het
Gm13723	A	T	2: 86,873,636	V29E	probably damaging	Het
Gm5145	G	A	17: 20,570,731	V124I	probably benign	Het
Grm7	T	C	6: 110,646,013	V49A	probably benign	Het
Gtf2e1	T	C	16: 37,536,065	D35G	probably damaging	Het
Heatr1	C	T	13: 12,421,060	Q1160*	probably null	Het
Herc2	T	A	7: 56,136,658	C1584S	probably benign	Het
Hsd17b3	T	C	13: 64,076,351	I88V	probably damaging	Het
Hspa14	A	C	2: 3,498,142	L205R	possibly damaging	Het
Ifna11	A	C	4: 88,820,425	E156A	possibly damaging	Het
Krt83	T	C	15: 101,489,647	D170G	probably benign	Het
Mas1	T	C	17: 12,841,858	Y226C	probably damaging	Het
Micall1	T	C	15: 79,120,897	F190L	unknown	Het
Msi2	A	T	11: 88,480,038	L141Q	probably damaging	Het
Nfkbib	T	C	7: 28,766,343	D27G	probably benign	Het
Nlrp9b	A	G	7: 20,049,513	D927G	possibly damaging	Het
Nrg3	T	C	14: 38,370,939	D579G	probably benign	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr26	G	A	9: 38,855,949	D296N	probably damaging	Het
Parp4	C	T	14: 56,647,681	P1406S	not run	Het
Pkib	A	T	10: 57,736,326	Q101L	possibly damaging	Het
Plat	C	T	8: 22,775,697	T252I	probably benign	Het
Ppm1d	A	T	11: 85,345,995	E533D	probably damaging	Het
Psd3	T	C	8: 68,121,034	K165R	probably damaging	Het
Psg29	T	A	7: 17,210,691	Y375*	probably null	Het
Pus7	A	T	5: 23,741,910	I644N	probably damaging	Het
Rbbp9	A	T	2: 144,543,802	M181K	probably benign	Het
Rell1	A	T	5: 63,936,075	N112K	possibly damaging	Het
Simc1	AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG	AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG	13: 54,525,235		probably benign	Het
Skint5	G	A	4: 113,542,934	T1184M	unknown	Het
Slc27a2	T	A	2: 126,578,946	D452E	probably damaging	Het
Slc44a4	T	A	17: 34,927,912	I489N	probably damaging	Het
Slfn14	T	A	11: 83,278,995	K608*	probably null	Het
Snx15	T	A	19: 6,120,507	I301F	probably damaging	Het
Sost	C	T	11: 101,964,103	G127R	probably damaging	Het
Stt3b	A	G	9: 115,276,957	I150T	probably damaging	Het
Susd2	T	C	10: 75,642,568	D58G	probably benign	Het
Tex46	T	G	4: 136,612,901	V99G	probably damaging	Het
Tgfbi	T	A	13: 56,632,113	F492I	possibly damaging	Het
Tmem132c	G	A	5: 127,360,217	A257T	probably benign	Het
Trim2	A	T	3: 84,210,233	I51K	probably damaging	Het
Tsn	A	T	1: 118,300,861	Y210*	probably null	Het
Umodl1	G	A	17: 31,008,665	R1324H	probably benign	Het
Utp3	G	C	5: 88,554,517		probably benign	Het
Vmn1r5	A	T	6: 56,986,219	N293I	possibly damaging	Het
Vmn2r124	A	T	17: 18,073,573	I641F	probably damaging	Het
Vmn2r84	T	C	10: 130,391,250	N240D	probably benign	Het
Wbp1l	A	G	19: 46,654,400	D264G	possibly damaging	Het

Other mutations in Dpp10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01592:Dpp10	APN	1	123334370	missense	probably damaging	1.00
IGL01618:Dpp10	APN	1	123367867	missense	probably benign
IGL02101:Dpp10	APN	1	123411826	missense	probably damaging	1.00
IGL02284:Dpp10	APN	1	124045366	splice site	probably benign
IGL02324:Dpp10	APN	1	123367802	missense	probably benign	0.02
IGL02391:Dpp10	APN	1	123650358	missense	probably damaging	0.98
IGL02458:Dpp10	APN	1	123341689	missense	probably benign	0.01
IGL02469:Dpp10	APN	1	123411803	missense	probably benign	0.01
IGL02501:Dpp10	APN	1	123686270	missense	possibly damaging	0.93
IGL02522:Dpp10	APN	1	123423652	missense	probably benign	0.24
IGL02672:Dpp10	APN	1	123376647	missense	probably benign	0.45
IGL03034:Dpp10	APN	1	123341619	missense	probably damaging	1.00
PIT1430001:Dpp10	UTSW	1	123341182	splice site	probably benign
R0104:Dpp10	UTSW	1	123367843	missense	probably benign	0.00
R0114:Dpp10	UTSW	1	123486092	missense	probably benign	0.07
R0242:Dpp10	UTSW	1	123398546	missense	possibly damaging	0.56
R0242:Dpp10	UTSW	1	123398546	missense	possibly damaging	0.56
R0682:Dpp10	UTSW	1	123905125	missense	probably damaging	0.98
R0815:Dpp10	UTSW	1	123432929	critical splice donor site	probably null
R1549:Dpp10	UTSW	1	123341380	critical splice acceptor site	probably null
R1742:Dpp10	UTSW	1	123445206	missense	probably damaging	1.00
R1859:Dpp10	UTSW	1	123353604	missense	possibly damaging	0.47
R1991:Dpp10	UTSW	1	123905106	missense	probably null	1.00
R1992:Dpp10	UTSW	1	123905106	missense	probably null	1.00
R2079:Dpp10	UTSW	1	123432992	missense	probably damaging	1.00
R2882:Dpp10	UTSW	1	123445203	missense	probably damaging	1.00
R2974:Dpp10	UTSW	1	123411705	splice site	probably benign
R3827:Dpp10	UTSW	1	123411790	missense	possibly damaging	0.56
R3852:Dpp10	UTSW	1	123485924	nonsense	probably null
R3876:Dpp10	UTSW	1	123353487	missense	probably damaging	0.98
R3899:Dpp10	UTSW	1	123353557	missense	probably damaging	1.00
R4735:Dpp10	UTSW	1	123398627	missense	probably benign	0.15
R4922:Dpp10	UTSW	1	123378153	missense	probably benign	0.44
R5457:Dpp10	UTSW	1	123411810	missense	possibly damaging	0.51
R5599:Dpp10	UTSW	1	123905076	missense	probably damaging	0.99
R5913:Dpp10	UTSW	1	123384289	missense	probably damaging	1.00
R5979:Dpp10	UTSW	1	123384283	critical splice donor site	probably null
R6378:Dpp10	UTSW	1	123411739	missense	probably damaging	1.00
R6429:Dpp10	UTSW	1	123367601	missense	possibly damaging	0.72
R6505:Dpp10	UTSW	1	123336851	missense	probably damaging	0.99
R6776:Dpp10	UTSW	1	123367656	nonsense	probably null
R6894:Dpp10	UTSW	1	123336864	missense	probably damaging	1.00
R6951:Dpp10	UTSW	1	123341650	missense	possibly damaging	0.93
R7182:Dpp10	UTSW	1	123341151	missense	probably benign	0.15
R7246:Dpp10	UTSW	1	123334377	missense	probably damaging	1.00
R7375:Dpp10	UTSW	1	123367795	missense	probably benign
R7387:Dpp10	UTSW	1	123341140	missense	probably benign	0.01
R7661:Dpp10	UTSW	1	123384952	missense	probably damaging	1.00
R8065:Dpp10	UTSW	1	123352660	missense	probably benign
R8067:Dpp10	UTSW	1	123352660	missense	probably benign
R8260:Dpp10	UTSW	1	123686295	missense	probably benign
R8324:Dpp10	UTSW	1	123854172	missense	probably benign	0.02
R8373:Dpp10	UTSW	1	123854229	missense	possibly damaging	0.94
R8434:Dpp10	UTSW	1	123433010	missense	probably damaging	1.00
R9068:Dpp10	UTSW	1	123432938	missense	probably damaging	1.00
R9104:Dpp10	UTSW	1	123411755	missense	probably damaging	1.00
R9477:Dpp10	UTSW	1	123376641	missense	possibly damaging	0.46
R9492:Dpp10	UTSW	1	123353430	missense	probably damaging	1.00
R9524:Dpp10	UTSW	1	123336882	missense	probably damaging	1.00
R9576:Dpp10	UTSW	1	123341680	missense	probably damaging	1.00
R9631:Dpp10	UTSW	1	123341703	missense	probably damaging	1.00
R9736:Dpp10	UTSW	1	123334359	missense	possibly damaging	0.64
X0019:Dpp10	UTSW	1	123398585	missense	possibly damaging	0.88
X0020:Dpp10	UTSW	1	123398582	missense	probably benign	0.36
X0021:Dpp10	UTSW	1	123432992	missense	probably damaging	1.00
X0024:Dpp10	UTSW	1	123384286	missense	probably damaging	1.00
Z1176:Dpp10	UTSW	1	123353440	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGACACCAATAACAGTGATAGATGC -3'
(R):5'- CTGCTGAAATGCTGGTTGC -3'

Sequencing Primer
(F):5'- TGCTTTTAAAAATGCAAGAAAGCTAC -3'
(R):5'- CTCATATTTGCAGGGATGAAGAACC -3'

Posted On

2019-06-26