Incidental Mutation 'R7297:Abca2'
ID566712
Institutional Source Beutler Lab
Gene Symbol Abca2
Ensembl Gene ENSMUSG00000026944
Gene NameATP-binding cassette, sub-family A (ABC1), member 2
SynonymsAbc2, D2H0S1474E
Accession Numbers

NCBI RefSeq: NM_007379.2; MGI: 99606

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7297 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location25428703-25448540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25442076 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1400 (D1400G)
Ref Sequence ENSEMBL: ENSMUSP00000099983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102919]
Predicted Effect probably benign
Transcript: ENSMUST00000102919
AA Change: D1400G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099983
Gene: ENSMUSG00000026944
AA Change: D1400G

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
coiled coil region 271 296 N/A INTRINSIC
low complexity region 309 346 N/A INTRINSIC
Pfam:ABC2_membrane_3 493 911 9.7e-18 PFAM
AAA 1015 1197 9.22e-7 SMART
low complexity region 1364 1376 N/A INTRINSIC
low complexity region 1589 1607 N/A INTRINSIC
Pfam:ABC2_membrane_3 1696 2008 2.3e-44 PFAM
AAA 2079 2264 1.12e-5 SMART
low complexity region 2375 2394 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 3697467; 3719855
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is highly expressed in brain tissue and may play a role in macrophage lipid metabolism and neural development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mice show tremors, hyperactivity, abnormal coordination, and alterations in CNS myelin sheath ultrastructure, [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 C T 11: 110,183,026 probably null Het
Adh4 A G 3: 138,429,140 I358M possibly damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Arap3 G A 18: 37,973,563 A1409V possibly damaging Het
Arhgap22 C T 14: 33,271,933 R68* probably null Het
Arhgef4 A T 1: 34,807,192 D207V probably damaging Het
Asb15 A G 6: 24,566,463 T472A probably damaging Het
Ascl1 A T 10: 87,492,464 S209T probably damaging Het
Asxl1 T C 2: 153,397,435 V382A probably benign Het
Atp11a T C 8: 12,806,774 probably null Het
Calu C T 6: 29,356,555 R27* probably null Het
Cdh20 A G 1: 104,970,873 T442A probably benign Het
Chrm3 T A 13: 9,877,833 Q389L probably benign Het
Cntnap1 A G 11: 101,188,634 T1233A probably benign Het
Cwc15 G A 9: 14,510,229 C197Y probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dennd3 C T 15: 73,557,610 T914I probably damaging Het
Dlx3 C A 11: 95,120,450 Y43* probably null Het
Dnah17 A T 11: 118,055,730 probably null Het
Dnah17 A G 11: 118,103,356 F1081S probably damaging Het
Dpp10 G A 1: 123,353,428 Q631* probably null Het
Dsel T A 1: 111,861,776 D343V probably damaging Het
Efcab12 T C 6: 115,811,036 D655G possibly damaging Het
Epha8 T A 4: 136,945,913 I187L probably damaging Het
Exosc10 A G 4: 148,580,377 K781E probably damaging Het
Exosc5 T C 7: 25,666,326 L200P probably benign Het
Faiml T C 9: 99,229,613 E131G probably damaging Het
Gm13723 A T 2: 86,873,636 V29E probably damaging Het
Gm5145 G A 17: 20,570,731 V124I probably benign Het
Grm7 T C 6: 110,646,013 V49A probably benign Het
Gtf2e1 T C 16: 37,536,065 D35G probably damaging Het
Heatr1 C T 13: 12,421,060 Q1160* probably null Het
Herc2 T A 7: 56,136,658 C1584S probably benign Het
Hsd17b3 T C 13: 64,076,351 I88V probably damaging Het
Hspa14 A C 2: 3,498,142 L205R possibly damaging Het
Ifna11 A C 4: 88,820,425 E156A possibly damaging Het
Krt83 T C 15: 101,489,647 D170G probably benign Het
Mas1 T C 17: 12,841,858 Y226C probably damaging Het
Micall1 T C 15: 79,120,897 F190L unknown Het
Msi2 A T 11: 88,480,038 L141Q probably damaging Het
Nfkbib T C 7: 28,766,343 D27G probably benign Het
Nlrp9b A G 7: 20,049,513 D927G possibly damaging Het
Nrg3 T C 14: 38,370,939 D579G probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr26 G A 9: 38,855,949 D296N probably damaging Het
Parp4 C T 14: 56,647,681 P1406S not run Het
Pkib A T 10: 57,736,326 Q101L possibly damaging Het
Plat C T 8: 22,775,697 T252I probably benign Het
Ppm1d A T 11: 85,345,995 E533D probably damaging Het
Psd3 T C 8: 68,121,034 K165R probably damaging Het
Psg29 T A 7: 17,210,691 Y375* probably null Het
Pus7 A T 5: 23,741,910 I644N probably damaging Het
Rbbp9 A T 2: 144,543,802 M181K probably benign Het
Rell1 A T 5: 63,936,075 N112K possibly damaging Het
Simc1 AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG 13: 54,525,235 probably benign Het
Skint5 G A 4: 113,542,934 T1184M unknown Het
Slc27a2 T A 2: 126,578,946 D452E probably damaging Het
Slc44a4 T A 17: 34,927,912 I489N probably damaging Het
Slfn14 T A 11: 83,278,995 K608* probably null Het
Snx15 T A 19: 6,120,507 I301F probably damaging Het
Sost C T 11: 101,964,103 G127R probably damaging Het
Stt3b A G 9: 115,276,957 I150T probably damaging Het
Susd2 T C 10: 75,642,568 D58G probably benign Het
Tex46 T G 4: 136,612,901 V99G probably damaging Het
Tgfbi T A 13: 56,632,113 F492I possibly damaging Het
Tmem132c G A 5: 127,360,217 A257T probably benign Het
Trim2 A T 3: 84,210,233 I51K probably damaging Het
Tsn A T 1: 118,300,861 Y210* probably null Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r5 A T 6: 56,986,219 N293I possibly damaging Het
Vmn2r124 A T 17: 18,073,573 I641F probably damaging Het
Vmn2r84 T C 10: 130,391,250 N240D probably benign Het
Wbp1l A G 19: 46,654,400 D264G possibly damaging Het
Other mutations in Abca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Abca2 APN 2 25445963 splice site probably null
IGL01102:Abca2 APN 2 25433956 splice site probably benign
IGL01322:Abca2 APN 2 25446782 splice site probably null
IGL01402:Abca2 APN 2 25442003 missense probably damaging 1.00
IGL01419:Abca2 APN 2 25437514 missense probably damaging 1.00
IGL01490:Abca2 APN 2 25446011 missense probably damaging 1.00
IGL01633:Abca2 APN 2 25444394 missense possibly damaging 0.66
IGL01661:Abca2 APN 2 25442995 missense probably benign 0.01
IGL01804:Abca2 APN 2 25446625 missense probably damaging 1.00
IGL01933:Abca2 APN 2 25444111 missense probably damaging 1.00
IGL01941:Abca2 APN 2 25443095 missense probably benign 0.02
IGL02158:Abca2 APN 2 25447879 utr 3 prime probably benign
IGL02173:Abca2 APN 2 25441897 missense probably benign 0.00
IGL02419:Abca2 APN 2 25446837 missense probably benign
IGL02532:Abca2 APN 2 25435136 missense probably benign 0.03
IGL02572:Abca2 APN 2 25433317 missense possibly damaging 0.95
Abseiling UTSW 2 25447003 missense possibly damaging 0.65
R0126:Abca2 UTSW 2 25443730 missense possibly damaging 0.88
R0140:Abca2 UTSW 2 25438085 critical splice donor site probably null
R0372:Abca2 UTSW 2 25437353 missense probably damaging 1.00
R0437:Abca2 UTSW 2 25442845 missense probably damaging 0.99
R0505:Abca2 UTSW 2 25434894 missense probably benign 0.22
R0570:Abca2 UTSW 2 25447405 splice site probably null
R1037:Abca2 UTSW 2 25438228 splice site probably benign
R1283:Abca2 UTSW 2 25446689 missense probably damaging 1.00
R1448:Abca2 UTSW 2 25440530 missense possibly damaging 0.73
R1464:Abca2 UTSW 2 25447834 splice site probably benign
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1480:Abca2 UTSW 2 25433397 missense possibly damaging 0.60
R1545:Abca2 UTSW 2 25442358 missense probably benign 0.17
R1562:Abca2 UTSW 2 25446319 missense probably benign 0.43
R1569:Abca2 UTSW 2 25439185 missense probably benign 0.45
R1586:Abca2 UTSW 2 25447216 missense probably damaging 0.98
R1635:Abca2 UTSW 2 25444856 missense probably benign 0.03
R1699:Abca2 UTSW 2 25447351 missense possibly damaging 0.80
R1754:Abca2 UTSW 2 25434333 missense probably benign 0.01
R1760:Abca2 UTSW 2 25443043 missense probably benign 0.00
R2040:Abca2 UTSW 2 25443805 missense probably damaging 1.00
R2067:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2111:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2248:Abca2 UTSW 2 25433464 splice site probably benign
R2323:Abca2 UTSW 2 25445175 missense probably benign 0.00
R2418:Abca2 UTSW 2 25437989 missense probably benign 0.22
R2419:Abca2 UTSW 2 25437989 missense probably benign 0.22
R3816:Abca2 UTSW 2 25446071 missense probably damaging 1.00
R4180:Abca2 UTSW 2 25441578 missense possibly damaging 0.58
R4431:Abca2 UTSW 2 25442852 missense probably benign
R4468:Abca2 UTSW 2 25444902 missense probably damaging 1.00
R4704:Abca2 UTSW 2 25443412 missense probably damaging 0.99
R4839:Abca2 UTSW 2 25440909 missense probably damaging 0.99
R4933:Abca2 UTSW 2 25444827 missense probably benign 0.25
R4970:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R4971:Abca2 UTSW 2 25441994 missense probably damaging 0.97
R5112:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R5327:Abca2 UTSW 2 25445674 missense probably damaging 1.00
R5378:Abca2 UTSW 2 25446068 missense probably damaging 1.00
R5648:Abca2 UTSW 2 25436498 critical splice donor site probably null
R5725:Abca2 UTSW 2 25439400 missense probably damaging 0.98
R5825:Abca2 UTSW 2 25436736 missense probably benign 0.36
R5837:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5840:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5851:Abca2 UTSW 2 25442310 missense possibly damaging 0.58
R6262:Abca2 UTSW 2 25444910 missense possibly damaging 0.56
R6344:Abca2 UTSW 2 25437694 missense probably damaging 1.00
R6547:Abca2 UTSW 2 25433338 missense possibly damaging 0.80
R6640:Abca2 UTSW 2 25447003 missense possibly damaging 0.65
R6980:Abca2 UTSW 2 25440866 missense possibly damaging 0.89
R6981:Abca2 UTSW 2 25444139 missense probably damaging 1.00
R7070:Abca2 UTSW 2 25442995 missense probably benign 0.06
R7080:Abca2 UTSW 2 25446104 missense probably benign 0.37
R7187:Abca2 UTSW 2 25437721 missense probably damaging 1.00
R7195:Abca2 UTSW 2 25442076 missense probably benign 0.00
R7487:Abca2 UTSW 2 25437903 missense probably benign 0.02
R7561:Abca2 UTSW 2 25446695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGCAGATGTGAAGGAGTCCC -3'
(R):5'- TGGAACTGCCGCATCTTCAG -3'

Sequencing Primer
(F):5'- CGGAAGGATGTGCTGCCTG -3'
(R):5'- GCATCTTCAGCCACCAGC -3'
Posted On2019-06-26