Mutagenetix > Incidental Mutation

Incidental Mutation 'R7297:Asxl1'

566717

Institutional Source

Beutler Lab

Gene Symbol

Asxl1

Ensembl Gene

ENSMUSG00000042548

Gene Name

additional sex combs like 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7297 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

153345829-153404007 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 153397435 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 382 (V382A)

Ref Sequence

ENSEMBL: ENSMUSP00000105413 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109790] [ENSMUST00000227428]

AlphaFold

P59598

Predicted Effect

probably benign
Transcript: ENSMUST00000109790
AA Change: V382A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000105413
Gene: ENSMUSG00000042548
AA Change: V382A

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	11	83	1.6e-20	PFAM
low complexity region	199	209	N/A	INTRINSIC
Pfam:ASXH	236	361	5.9e-40	PFAM
low complexity region	411	422	N/A	INTRINSIC
low complexity region	639	667	N/A	INTRINSIC
low complexity region	705	716	N/A	INTRINSIC
low complexity region	848	860	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
Pfam:PHD_3	1446	1512	6.3e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000227428
AA Change: V381A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Disruption of this gene causes alterations in lymphocyte development in adult mice. Mice homozygous for a different knock-out allele exhibit complete lethality. Mice heterozygous for this allele exhibit eye opacity and abnormal vertebrae morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	A	G	2: 25,442,076	D1400G	probably benign	Het
Abca6	C	T	11: 110,183,026		probably null	Het
Adh4	A	G	3: 138,429,140	I358M	possibly damaging	Het
Akap6	T	G	12: 52,887,364	D546E	probably benign	Het
Arap3	G	A	18: 37,973,563	A1409V	possibly damaging	Het
Arhgap22	C	T	14: 33,271,933	R68*	probably null	Het
Arhgef4	A	T	1: 34,807,192	D207V	probably damaging	Het
Asb15	A	G	6: 24,566,463	T472A	probably damaging	Het
Ascl1	A	T	10: 87,492,464	S209T	probably damaging	Het
Atp11a	T	C	8: 12,806,774		probably null	Het
Calu	C	T	6: 29,356,555	R27*	probably null	Het
Cdh20	A	G	1: 104,970,873	T442A	probably benign	Het
Chrm3	T	A	13: 9,877,833	Q389L	probably benign	Het
Cntnap1	A	G	11: 101,188,634	T1233A	probably benign	Het
Cwc15	G	A	9: 14,510,229	C197Y	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dennd3	C	T	15: 73,557,610	T914I	probably damaging	Het
Dlx3	C	A	11: 95,120,450	Y43*	probably null	Het
Dnah17	A	T	11: 118,055,730		probably null	Het
Dnah17	A	G	11: 118,103,356	F1081S	probably damaging	Het
Dpp10	G	A	1: 123,353,428	Q631*	probably null	Het
Dsel	T	A	1: 111,861,776	D343V	probably damaging	Het
Efcab12	T	C	6: 115,811,036	D655G	possibly damaging	Het
Epha8	T	A	4: 136,945,913	I187L	probably damaging	Het
Exosc10	A	G	4: 148,580,377	K781E	probably damaging	Het
Exosc5	T	C	7: 25,666,326	L200P	probably benign	Het
Faiml	T	C	9: 99,229,613	E131G	probably damaging	Het
Gm13723	A	T	2: 86,873,636	V29E	probably damaging	Het
Gm5145	G	A	17: 20,570,731	V124I	probably benign	Het
Grm7	T	C	6: 110,646,013	V49A	probably benign	Het
Gtf2e1	T	C	16: 37,536,065	D35G	probably damaging	Het
Heatr1	C	T	13: 12,421,060	Q1160*	probably null	Het
Herc2	T	A	7: 56,136,658	C1584S	probably benign	Het
Hsd17b3	T	C	13: 64,076,351	I88V	probably damaging	Het
Hspa14	A	C	2: 3,498,142	L205R	possibly damaging	Het
Ifna11	A	C	4: 88,820,425	E156A	possibly damaging	Het
Krt83	T	C	15: 101,489,647	D170G	probably benign	Het
Mas1	T	C	17: 12,841,858	Y226C	probably damaging	Het
Micall1	T	C	15: 79,120,897	F190L	unknown	Het
Msi2	A	T	11: 88,480,038	L141Q	probably damaging	Het
Nfkbib	T	C	7: 28,766,343	D27G	probably benign	Het
Nlrp9b	A	G	7: 20,049,513	D927G	possibly damaging	Het
Nrg3	T	C	14: 38,370,939	D579G	probably benign	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr26	G	A	9: 38,855,949	D296N	probably damaging	Het
Parp4	C	T	14: 56,647,681	P1406S	not run	Het
Pkib	A	T	10: 57,736,326	Q101L	possibly damaging	Het
Plat	C	T	8: 22,775,697	T252I	probably benign	Het
Ppm1d	A	T	11: 85,345,995	E533D	probably damaging	Het
Psd3	T	C	8: 68,121,034	K165R	probably damaging	Het
Psg29	T	A	7: 17,210,691	Y375*	probably null	Het
Pus7	A	T	5: 23,741,910	I644N	probably damaging	Het
Rbbp9	A	T	2: 144,543,802	M181K	probably benign	Het
Rell1	A	T	5: 63,936,075	N112K	possibly damaging	Het
Simc1	AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG	AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG	13: 54,525,235		probably benign	Het
Skint5	G	A	4: 113,542,934	T1184M	unknown	Het
Slc27a2	T	A	2: 126,578,946	D452E	probably damaging	Het
Slc44a4	T	A	17: 34,927,912	I489N	probably damaging	Het
Slfn14	T	A	11: 83,278,995	K608*	probably null	Het
Snx15	T	A	19: 6,120,507	I301F	probably damaging	Het
Sost	C	T	11: 101,964,103	G127R	probably damaging	Het
Stt3b	A	G	9: 115,276,957	I150T	probably damaging	Het
Susd2	T	C	10: 75,642,568	D58G	probably benign	Het
Tex46	T	G	4: 136,612,901	V99G	probably damaging	Het
Tgfbi	T	A	13: 56,632,113	F492I	possibly damaging	Het
Tmem132c	G	A	5: 127,360,217	A257T	probably benign	Het
Trim2	A	T	3: 84,210,233	I51K	probably damaging	Het
Tsn	A	T	1: 118,300,861	Y210*	probably null	Het
Umodl1	G	A	17: 31,008,665	R1324H	probably benign	Het
Utp3	G	C	5: 88,554,517		probably benign	Het
Vmn1r5	A	T	6: 56,986,219	N293I	possibly damaging	Het
Vmn2r124	A	T	17: 18,073,573	I641F	probably damaging	Het
Vmn2r84	T	C	10: 130,391,250	N240D	probably benign	Het
Wbp1l	A	G	19: 46,654,400	D264G	possibly damaging	Het

Other mutations in Asxl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01409:Asxl1	APN	2	153392940	splice site	probably benign
IGL01432:Asxl1	APN	2	153400205	missense	probably benign	0.38
IGL01543:Asxl1	APN	2	153401484	missense	probably benign	0.11
IGL02355:Asxl1	APN	2	153401786	missense	probably benign	0.34
IGL02362:Asxl1	APN	2	153401786	missense	probably benign	0.34
IGL02645:Asxl1	APN	2	153392857	missense	possibly damaging	0.94
IGL02696:Asxl1	APN	2	153400195	nonsense	probably null
IGL03365:Asxl1	APN	2	153401754	missense	probably damaging	1.00
IGL03372:Asxl1	APN	2	153400413	missense	probably damaging	0.99
IGL03377:Asxl1	APN	2	153396780	missense	probably damaging	1.00
astrophel	UTSW	2	153400106	missense	possibly damaging	0.75
hairbrush	UTSW	2	153400724	missense	possibly damaging	0.55
R0044:Asxl1	UTSW	2	153400209	missense	probably benign	0.06
R0044:Asxl1	UTSW	2	153400209	missense	probably benign	0.06
R0600:Asxl1	UTSW	2	153399904	missense	probably benign	0.00
R0659:Asxl1	UTSW	2	153400724	missense	possibly damaging	0.55
R0661:Asxl1	UTSW	2	153400724	missense	possibly damaging	0.55
R0684:Asxl1	UTSW	2	153397522	missense	probably damaging	1.00
R1606:Asxl1	UTSW	2	153400455	missense	probably damaging	0.99
R1747:Asxl1	UTSW	2	153393454	missense	possibly damaging	0.86
R1796:Asxl1	UTSW	2	153401606	missense	probably benign	0.31
R1914:Asxl1	UTSW	2	153401906	missense	probably damaging	1.00
R2099:Asxl1	UTSW	2	153352267	missense	possibly damaging	0.95
R2373:Asxl1	UTSW	2	153401900	missense	probably benign	0.13
R2910:Asxl1	UTSW	2	153401039	missense	probably benign	0.00
R3620:Asxl1	UTSW	2	153357155	missense	probably damaging	1.00
R3701:Asxl1	UTSW	2	153399344	missense	probably benign	0.04
R4200:Asxl1	UTSW	2	153400106	missense	possibly damaging	0.75
R4773:Asxl1	UTSW	2	153401985	missense	probably damaging	1.00
R4902:Asxl1	UTSW	2	153399831	missense	probably benign	0.02
R5100:Asxl1	UTSW	2	153397931	missense	probably damaging	1.00
R5102:Asxl1	UTSW	2	153400955	missense	probably benign	0.00
R5166:Asxl1	UTSW	2	153401121	missense	probably damaging	1.00
R5421:Asxl1	UTSW	2	153399584	missense	probably benign	0.04
R5701:Asxl1	UTSW	2	153399489	missense	probably damaging	1.00
R5861:Asxl1	UTSW	2	153399390	missense	probably damaging	0.99
R5973:Asxl1	UTSW	2	153402011	missense	probably damaging	0.97
R6384:Asxl1	UTSW	2	153391824	critical splice donor site	probably null
R7023:Asxl1	UTSW	2	153400549	missense	probably benign	0.00
R7028:Asxl1	UTSW	2	153400107	missense	probably benign	0.00
R7176:Asxl1	UTSW	2	153401988	missense	probably damaging	1.00
R7378:Asxl1	UTSW	2	153401993	missense	probably damaging	1.00
R7464:Asxl1	UTSW	2	153397785	missense	probably benign	0.01
R7678:Asxl1	UTSW	2	153400652	missense	probably damaging	1.00
R7686:Asxl1	UTSW	2	153391614	missense	probably damaging	1.00
R7789:Asxl1	UTSW	2	153400023	missense	probably benign	0.00
R7838:Asxl1	UTSW	2	153396813	missense	probably damaging	1.00
R7898:Asxl1	UTSW	2	153399934	missense	possibly damaging	0.65
R8281:Asxl1	UTSW	2	153399401	missense	probably damaging	1.00
R8354:Asxl1	UTSW	2	153393425	missense	probably benign	0.40
R8383:Asxl1	UTSW	2	153393719	missense	probably damaging	1.00
R8995:Asxl1	UTSW	2	153393966	missense	probably damaging	1.00
R9183:Asxl1	UTSW	2	153397920	missense	probably damaging	0.99
X0024:Asxl1	UTSW	2	153401985	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGAACTGACTGCCGCTTG -3'
(R):5'- CAGCACTTGCATCTTTAGCAAC -3'

Sequencing Primer
(F):5'- CCGCTTGACAGTGAAGCTATTG -3'
(R):5'- TGCATCTTTAGCAACCCCTG -3'

Posted On

2019-06-26