Incidental Mutation 'R0636:Tigd2'
ID56672
Institutional Source Beutler Lab
Gene Symbol Tigd2
Ensembl Gene ENSMUSG00000049232
Gene Nametigger transposable element derived 2
Synonyms3632410O17Rik
MMRRC Submission 038825-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0636 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location59208870-59212033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59211287 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 380 (T380A)
Ref Sequence ENSEMBL: ENSMUSP00000057223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062626]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062626
AA Change: T380A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000057223
Gene: ENSMUSG00000049232
AA Change: T380A

DomainStartEndE-ValueType
Pfam:CENP-B_N 4 54 6e-17 PFAM
CENPB 73 139 5.78e-19 SMART
Pfam:DDE_1 206 385 2.2e-52 PFAM
low complexity region 504 519 N/A INTRINSIC
Meta Mutation Damage Score 0.2202 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,231,217 Y264C probably damaging Het
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Aco1 A G 4: 40,175,697 E146G probably damaging Het
Adam2 T G 14: 66,034,816 D639A probably benign Het
Adh4 G T 3: 138,428,074 R315L probably damaging Het
Adprhl1 T C 8: 13,248,702 D76G probably damaging Het
AF366264 T C 8: 13,837,870 R74G probably benign Het
Akip1 T C 7: 109,707,519 probably benign Het
Ap3d1 T A 10: 80,719,382 K370* probably null Het
Arfgef1 C A 1: 10,199,851 V358L probably benign Het
Arpp21 A T 9: 112,183,498 D85E probably benign Het
Azi2 A T 9: 118,062,057 L383F probably benign Het
Bpgm T A 6: 34,504,287 D206E probably benign Het
Bsn T C 9: 108,107,834 D3007G unknown Het
Ccdc142 T G 6: 83,107,198 probably benign Het
Cep135 T C 5: 76,615,657 V498A probably benign Het
Cntn6 A T 6: 104,863,148 Q1003L probably benign Het
Cntnap2 T A 6: 47,296,708 probably benign Het
Csf2rb2 G A 15: 78,291,960 Q139* probably null Het
Cyp3a16 A G 5: 145,463,085 V101A probably benign Het
D630045J12Rik T C 6: 38,196,778 T152A probably benign Het
Def8 G A 8: 123,454,357 W176* probably null Het
Dgkg A G 16: 22,579,729 probably benign Het
Ear10 T C 14: 43,922,994 probably null Het
Fbxw2 A T 2: 34,822,847 Y67* probably null Het
Flii T A 11: 60,715,552 Y1104F probably damaging Het
Gm973 G A 1: 59,551,144 R270K probably benign Het
Gm9833 T C 3: 10,088,783 L204P possibly damaging Het
Gnl3 T A 14: 31,017,153 K75N probably damaging Het
Gpc6 A T 14: 117,624,493 M274L probably benign Het
Ifi47 A G 11: 49,096,651 E415G possibly damaging Het
Ift57 A G 16: 49,711,896 T130A probably benign Het
Itpr2 T A 6: 146,171,412 D2373V probably damaging Het
Kat6a T C 8: 22,939,323 S1565P possibly damaging Het
Klhl6 A T 16: 19,948,073 probably benign Het
Klra2 T C 6: 131,220,104 probably benign Het
Lama5 A G 2: 180,189,331 probably null Het
Mapk4 A G 18: 73,930,454 S566P probably benign Het
Mindy4 C A 6: 55,276,585 R480S possibly damaging Het
Mterf3 T C 13: 66,922,753 probably benign Het
Mtmr2 A G 9: 13,801,913 probably null Het
Naip5 T C 13: 100,219,688 T1140A probably benign Het
Nf1 A G 11: 79,535,703 T1648A probably damaging Het
Nlk A T 11: 78,695,844 D141E probably benign Het
Noxa1 C A 2: 25,086,094 probably benign Het
Olfr1279 A G 2: 111,306,412 N69S probably benign Het
Olfr1480 A T 19: 13,530,249 Y236F possibly damaging Het
Olfr476 T C 7: 107,967,472 V25A probably benign Het
Otog G A 7: 46,264,228 probably null Het
Pebp4 T C 14: 70,048,347 probably benign Het
Phgdh G T 3: 98,333,291 N100K possibly damaging Het
Pnisr T A 4: 21,873,800 probably benign Het
Ptpn6 T C 6: 124,725,279 H346R probably benign Het
Rsf1 T C 7: 97,662,019 V652A possibly damaging Het
Rubcn G A 16: 32,828,686 H624Y probably damaging Het
Setdb2 T C 14: 59,406,704 N656D probably benign Het
Slc22a23 T C 13: 34,299,093 T268A probably benign Het
Slc3a1 A T 17: 85,032,794 T215S possibly damaging Het
Srsf2 A G 11: 116,852,078 S206P probably benign Het
Susd2 T A 10: 75,639,350 D542V probably damaging Het
Svep1 G A 4: 58,073,121 Q2063* probably null Het
Syne2 G A 12: 75,930,983 V1401M possibly damaging Het
Tenm2 A G 11: 36,943,976 L64P probably damaging Het
Trmt12 G T 15: 58,873,985 V411F probably damaging Het
Ubr4 T C 4: 139,436,302 probably null Het
Ush2a G A 1: 188,822,738 C3571Y probably benign Het
Usp8 A G 2: 126,720,110 M75V possibly damaging Het
Vcan C T 13: 89,704,706 D712N probably damaging Het
Vcan C A 13: 89,712,267 R327L probably damaging Het
Vps8 A G 16: 21,434,933 E8G probably benign Het
Washc5 T C 15: 59,359,409 D335G probably benign Het
Zbtb39 A G 10: 127,742,835 N426S probably benign Het
Zfp184 T A 13: 21,949,749 D55E probably damaging Het
Zfp882 T C 8: 71,914,337 V336A probably benign Het
Other mutations in Tigd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02304:Tigd2 APN 6 59211698 nonsense probably null
IGL03356:Tigd2 APN 6 59211705 missense probably benign 0.04
PIT1430001:Tigd2 UTSW 6 59211248 missense probably damaging 1.00
R0048:Tigd2 UTSW 6 59211384 missense possibly damaging 0.86
R0387:Tigd2 UTSW 6 59211158 missense probably benign 0.00
R0523:Tigd2 UTSW 6 59210373 missense probably benign 0.30
R1171:Tigd2 UTSW 6 59211376 missense possibly damaging 0.73
R2440:Tigd2 UTSW 6 59209995 start gained probably benign
R4327:Tigd2 UTSW 6 59210577 missense probably benign 0.36
R4731:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R4732:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R4733:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R5005:Tigd2 UTSW 6 59211146 missense probably benign 0.06
R5028:Tigd2 UTSW 6 59211220 nonsense probably null
R5248:Tigd2 UTSW 6 59211153 missense probably damaging 1.00
R6006:Tigd2 UTSW 6 59210777 missense possibly damaging 0.45
R7099:Tigd2 UTSW 6 59210181 missense probably damaging 1.00
R7261:Tigd2 UTSW 6 59211067 missense probably benign 0.02
R7553:Tigd2 UTSW 6 59211579 missense probably benign 0.04
R7688:Tigd2 UTSW 6 59210397 missense probably damaging 1.00
R8002:Tigd2 UTSW 6 59210509 missense probably damaging 1.00
Z1177:Tigd2 UTSW 6 59211530 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCATCTGAAATCCAAAGGGCTTCG -3'
(R):5'- TGCAGCACCTACAATGTCAGCTAAC -3'

Sequencing Primer
(F):5'- cacaagtctaattcaacctatgagcc -3'
(R):5'- GTCAGCTAACACCTGACAGTTTG -3'
Posted On2013-07-11