Incidental Mutation 'R0636:Cntn6'
ID56674
Institutional Source Beutler Lab
Gene Symbol Cntn6
Ensembl Gene ENSMUSG00000030092
Gene Namecontactin 6
SynonymsNB-3
MMRRC Submission 038825-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R0636 (G1)
Quality Score195
Status Validated
Chromosome6
Chromosomal Location104492790-104863406 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104863148 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1003 (Q1003L)
Ref Sequence ENSEMBL: ENSMUSP00000124025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]
Predicted Effect probably benign
Transcript: ENSMUST00000089215
AA Change: Q1003L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: Q1003L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161070
AA Change: Q931L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: Q931L

DomainStartEndE-ValueType
SCOP:d1cs6a4 4 40 5e-4 SMART
IG 57 145 2.28e-7 SMART
IGc2 168 232 4e-12 SMART
IGc2 258 321 4.52e-11 SMART
IGc2 350 414 5.48e-10 SMART
IGc2 440 512 1.44e-4 SMART
FN3 526 612 2.17e-11 SMART
FN3 629 715 8.62e0 SMART
FN3 731 816 9.92e-6 SMART
FN3 831 911 8.17e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162872
AA Change: Q1003L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: Q1003L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Meta Mutation Damage Score 0.0989 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,231,217 Y264C probably damaging Het
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Aco1 A G 4: 40,175,697 E146G probably damaging Het
Adam2 T G 14: 66,034,816 D639A probably benign Het
Adh4 G T 3: 138,428,074 R315L probably damaging Het
Adprhl1 T C 8: 13,248,702 D76G probably damaging Het
AF366264 T C 8: 13,837,870 R74G probably benign Het
Akip1 T C 7: 109,707,519 probably benign Het
Ap3d1 T A 10: 80,719,382 K370* probably null Het
Arfgef1 C A 1: 10,199,851 V358L probably benign Het
Arpp21 A T 9: 112,183,498 D85E probably benign Het
Azi2 A T 9: 118,062,057 L383F probably benign Het
Bpgm T A 6: 34,504,287 D206E probably benign Het
Bsn T C 9: 108,107,834 D3007G unknown Het
Ccdc142 T G 6: 83,107,198 probably benign Het
Cep135 T C 5: 76,615,657 V498A probably benign Het
Cntnap2 T A 6: 47,296,708 probably benign Het
Csf2rb2 G A 15: 78,291,960 Q139* probably null Het
Cyp3a16 A G 5: 145,463,085 V101A probably benign Het
D630045J12Rik T C 6: 38,196,778 T152A probably benign Het
Def8 G A 8: 123,454,357 W176* probably null Het
Dgkg A G 16: 22,579,729 probably benign Het
Ear10 T C 14: 43,922,994 probably null Het
Fbxw2 A T 2: 34,822,847 Y67* probably null Het
Flii T A 11: 60,715,552 Y1104F probably damaging Het
Gm973 G A 1: 59,551,144 R270K probably benign Het
Gm9833 T C 3: 10,088,783 L204P possibly damaging Het
Gnl3 T A 14: 31,017,153 K75N probably damaging Het
Gpc6 A T 14: 117,624,493 M274L probably benign Het
Ifi47 A G 11: 49,096,651 E415G possibly damaging Het
Ift57 A G 16: 49,711,896 T130A probably benign Het
Itpr2 T A 6: 146,171,412 D2373V probably damaging Het
Kat6a T C 8: 22,939,323 S1565P possibly damaging Het
Klhl6 A T 16: 19,948,073 probably benign Het
Klra2 T C 6: 131,220,104 probably benign Het
Lama5 A G 2: 180,189,331 probably null Het
Mapk4 A G 18: 73,930,454 S566P probably benign Het
Mindy4 C A 6: 55,276,585 R480S possibly damaging Het
Mterf3 T C 13: 66,922,753 probably benign Het
Mtmr2 A G 9: 13,801,913 probably null Het
Naip5 T C 13: 100,219,688 T1140A probably benign Het
Nf1 A G 11: 79,535,703 T1648A probably damaging Het
Nlk A T 11: 78,695,844 D141E probably benign Het
Noxa1 C A 2: 25,086,094 probably benign Het
Olfr1279 A G 2: 111,306,412 N69S probably benign Het
Olfr1480 A T 19: 13,530,249 Y236F possibly damaging Het
Olfr476 T C 7: 107,967,472 V25A probably benign Het
Otog G A 7: 46,264,228 probably null Het
Pebp4 T C 14: 70,048,347 probably benign Het
Phgdh G T 3: 98,333,291 N100K possibly damaging Het
Pnisr T A 4: 21,873,800 probably benign Het
Ptpn6 T C 6: 124,725,279 H346R probably benign Het
Rsf1 T C 7: 97,662,019 V652A possibly damaging Het
Rubcn G A 16: 32,828,686 H624Y probably damaging Het
Setdb2 T C 14: 59,406,704 N656D probably benign Het
Slc22a23 T C 13: 34,299,093 T268A probably benign Het
Slc3a1 A T 17: 85,032,794 T215S possibly damaging Het
Srsf2 A G 11: 116,852,078 S206P probably benign Het
Susd2 T A 10: 75,639,350 D542V probably damaging Het
Svep1 G A 4: 58,073,121 Q2063* probably null Het
Syne2 G A 12: 75,930,983 V1401M possibly damaging Het
Tenm2 A G 11: 36,943,976 L64P probably damaging Het
Tigd2 A G 6: 59,211,287 T380A possibly damaging Het
Trmt12 G T 15: 58,873,985 V411F probably damaging Het
Ubr4 T C 4: 139,436,302 probably null Het
Ush2a G A 1: 188,822,738 C3571Y probably benign Het
Usp8 A G 2: 126,720,110 M75V possibly damaging Het
Vcan C T 13: 89,704,706 D712N probably damaging Het
Vcan C A 13: 89,712,267 R327L probably damaging Het
Vps8 A G 16: 21,434,933 E8G probably benign Het
Washc5 T C 15: 59,359,409 D335G probably benign Het
Zbtb39 A G 10: 127,742,835 N426S probably benign Het
Zfp184 T A 13: 21,949,749 D55E probably damaging Het
Zfp882 T C 8: 71,914,337 V336A probably benign Het
Other mutations in Cntn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Cntn6 APN 6 104650400 missense probably damaging 0.99
IGL01331:Cntn6 APN 6 104774523 missense probably damaging 1.00
IGL01619:Cntn6 APN 6 104728374 splice site probably benign
IGL02028:Cntn6 APN 6 104859426 missense probably damaging 0.99
IGL02420:Cntn6 APN 6 104846142 critical splice donor site probably null
IGL02557:Cntn6 APN 6 104774535 missense probably damaging 1.00
IGL03000:Cntn6 APN 6 104804386 missense probably damaging 1.00
IGL03367:Cntn6 APN 6 104804338 missense probably damaging 1.00
IGL03383:Cntn6 APN 6 104776457 splice site probably benign
PIT4366001:Cntn6 UTSW 6 104832537 missense probably benign 0.05
R0490:Cntn6 UTSW 6 104833918 missense possibly damaging 0.91
R0583:Cntn6 UTSW 6 104776314 missense possibly damaging 0.79
R0654:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R0960:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R1241:Cntn6 UTSW 6 104832509 missense probably damaging 1.00
R1385:Cntn6 UTSW 6 104861900 missense probably benign 0.07
R1401:Cntn6 UTSW 6 104804398 missense possibly damaging 0.65
R1478:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R1542:Cntn6 UTSW 6 104848100 missense probably damaging 1.00
R1593:Cntn6 UTSW 6 104832580 missense possibly damaging 0.58
R1840:Cntn6 UTSW 6 104774480 missense probably damaging 1.00
R2066:Cntn6 UTSW 6 104861822 nonsense probably null
R2097:Cntn6 UTSW 6 104861949 missense probably damaging 0.99
R2289:Cntn6 UTSW 6 104569028 start gained probably benign
R2429:Cntn6 UTSW 6 104650565 missense possibly damaging 0.96
R2967:Cntn6 UTSW 6 104726237 missense probably benign 0.04
R4009:Cntn6 UTSW 6 104833822 missense probably damaging 0.98
R4476:Cntn6 UTSW 6 104772561 missense probably damaging 1.00
R4664:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4666:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4701:Cntn6 UTSW 6 104804360 missense probably benign 0.01
R4780:Cntn6 UTSW 6 104845784 missense probably damaging 1.00
R4854:Cntn6 UTSW 6 104859475 missense possibly damaging 0.95
R4965:Cntn6 UTSW 6 104774474 missense probably damaging 0.99
R5051:Cntn6 UTSW 6 104772597 missense probably damaging 1.00
R5075:Cntn6 UTSW 6 104833030 missense probably damaging 1.00
R5152:Cntn6 UTSW 6 104569113 intron probably benign
R5291:Cntn6 UTSW 6 104726135 missense probably damaging 1.00
R5388:Cntn6 UTSW 6 104832562 missense probably damaging 1.00
R5852:Cntn6 UTSW 6 104835745 missense probably damaging 0.97
R5937:Cntn6 UTSW 6 104833103 missense possibly damaging 0.68
R5980:Cntn6 UTSW 6 104848132 missense probably damaging 0.98
R6290:Cntn6 UTSW 6 104767890 missense probably damaging 1.00
R6338:Cntn6 UTSW 6 104726139 missense probably damaging 1.00
R6396:Cntn6 UTSW 6 104650500 missense probably damaging 1.00
R6447:Cntn6 UTSW 6 104859448 missense probably damaging 1.00
R6860:Cntn6 UTSW 6 104861946 missense possibly damaging 0.95
R6871:Cntn6 UTSW 6 104845758 frame shift probably null
R7012:Cntn6 UTSW 6 104726262 missense probably damaging 0.98
R7012:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R7337:Cntn6 UTSW 6 104650530 missense probably damaging 0.99
R7658:Cntn6 UTSW 6 104650483 missense probably benign 0.29
R8133:Cntn6 UTSW 6 104728337 missense probably benign 0.19
X0020:Cntn6 UTSW 6 104767884 missense probably benign 0.00
Z1177:Cntn6 UTSW 6 104832584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTAGTCCTCACCAATTTGGGCAC -3'
(R):5'- AGACACAGCAGTTTTATGTCCTCCG -3'

Sequencing Primer
(F):5'- TGAGGTGGCATCTTATAATAGGAG -3'
(R):5'- GGCACCCTCAAATGTGTAATG -3'
Posted On2013-07-11