Mutagenetix > Incidental Mutation

Incidental Mutation 'R0636:Cntn6'

56674

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

038825-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R0636 (G1)

Quality Score

195

Status

Validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104863148 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 1003 (Q1003L)

Ref Sequence

ENSEMBL: ENSMUSP00000124025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

probably benign
Transcript: ENSMUST00000089215
AA Change: Q1003L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: Q1003L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161070
AA Change: Q931L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: Q931L

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162872
AA Change: Q1003L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: Q1003L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Meta Mutation Damage Score

0.0989

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.7%

Validation Efficiency

96% (74/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	T	C	4: 103,231,217	Y264C	probably damaging	Het
8030423J24Rik	T	C	13: 70,884,225	F139L	unknown	Het
Aco1	A	G	4: 40,175,697	E146G	probably damaging	Het
Adam2	T	G	14: 66,034,816	D639A	probably benign	Het
Adh4	G	T	3: 138,428,074	R315L	probably damaging	Het
Adprhl1	T	C	8: 13,248,702	D76G	probably damaging	Het
AF366264	T	C	8: 13,837,870	R74G	probably benign	Het
Akip1	T	C	7: 109,707,519		probably benign	Het
Ap3d1	T	A	10: 80,719,382	K370*	probably null	Het
Arfgef1	C	A	1: 10,199,851	V358L	probably benign	Het
Arpp21	A	T	9: 112,183,498	D85E	probably benign	Het
Azi2	A	T	9: 118,062,057	L383F	probably benign	Het
Bpgm	T	A	6: 34,504,287	D206E	probably benign	Het
Bsn	T	C	9: 108,107,834	D3007G	unknown	Het
Ccdc142	T	G	6: 83,107,198		probably benign	Het
Cep135	T	C	5: 76,615,657	V498A	probably benign	Het
Cntnap2	T	A	6: 47,296,708		probably benign	Het
Csf2rb2	G	A	15: 78,291,960	Q139*	probably null	Het
Cyp3a16	A	G	5: 145,463,085	V101A	probably benign	Het
D630045J12Rik	T	C	6: 38,196,778	T152A	probably benign	Het
Def8	G	A	8: 123,454,357	W176*	probably null	Het
Dgkg	A	G	16: 22,579,729		probably benign	Het
Ear10	T	C	14: 43,922,994		probably null	Het
Fbxw2	A	T	2: 34,822,847	Y67*	probably null	Het
Flii	T	A	11: 60,715,552	Y1104F	probably damaging	Het
Gm973	G	A	1: 59,551,144	R270K	probably benign	Het
Gm9833	T	C	3: 10,088,783	L204P	possibly damaging	Het
Gnl3	T	A	14: 31,017,153	K75N	probably damaging	Het
Gpc6	A	T	14: 117,624,493	M274L	probably benign	Het
Ifi47	A	G	11: 49,096,651	E415G	possibly damaging	Het
Ift57	A	G	16: 49,711,896	T130A	probably benign	Het
Itpr2	T	A	6: 146,171,412	D2373V	probably damaging	Het
Kat6a	T	C	8: 22,939,323	S1565P	possibly damaging	Het
Klhl6	A	T	16: 19,948,073		probably benign	Het
Klra2	T	C	6: 131,220,104		probably benign	Het
Lama5	A	G	2: 180,189,331		probably null	Het
Mapk4	A	G	18: 73,930,454	S566P	probably benign	Het
Mindy4	C	A	6: 55,276,585	R480S	possibly damaging	Het
Mterf3	T	C	13: 66,922,753		probably benign	Het
Mtmr2	A	G	9: 13,801,913		probably null	Het
Naip5	T	C	13: 100,219,688	T1140A	probably benign	Het
Nf1	A	G	11: 79,535,703	T1648A	probably damaging	Het
Nlk	A	T	11: 78,695,844	D141E	probably benign	Het
Noxa1	C	A	2: 25,086,094		probably benign	Het
Olfr1279	A	G	2: 111,306,412	N69S	probably benign	Het
Olfr1480	A	T	19: 13,530,249	Y236F	possibly damaging	Het
Olfr476	T	C	7: 107,967,472	V25A	probably benign	Het
Otog	G	A	7: 46,264,228		probably null	Het
Pebp4	T	C	14: 70,048,347		probably benign	Het
Phgdh	G	T	3: 98,333,291	N100K	possibly damaging	Het
Pnisr	T	A	4: 21,873,800		probably benign	Het
Ptpn6	T	C	6: 124,725,279	H346R	probably benign	Het
Rsf1	T	C	7: 97,662,019	V652A	possibly damaging	Het
Rubcn	G	A	16: 32,828,686	H624Y	probably damaging	Het
Setdb2	T	C	14: 59,406,704	N656D	probably benign	Het
Slc22a23	T	C	13: 34,299,093	T268A	probably benign	Het
Slc3a1	A	T	17: 85,032,794	T215S	possibly damaging	Het
Srsf2	A	G	11: 116,852,078	S206P	probably benign	Het
Susd2	T	A	10: 75,639,350	D542V	probably damaging	Het
Svep1	G	A	4: 58,073,121	Q2063*	probably null	Het
Syne2	G	A	12: 75,930,983	V1401M	possibly damaging	Het
Tenm2	A	G	11: 36,943,976	L64P	probably damaging	Het
Tigd2	A	G	6: 59,211,287	T380A	possibly damaging	Het
Trmt12	G	T	15: 58,873,985	V411F	probably damaging	Het
Ubr4	T	C	4: 139,436,302		probably null	Het
Ush2a	G	A	1: 188,822,738	C3571Y	probably benign	Het
Usp8	A	G	2: 126,720,110	M75V	possibly damaging	Het
Vcan	C	T	13: 89,704,706	D712N	probably damaging	Het
Vcan	C	A	13: 89,712,267	R327L	probably damaging	Het
Vps8	A	G	16: 21,434,933	E8G	probably benign	Het
Washc5	T	C	15: 59,359,409	D335G	probably benign	Het
Zbtb39	A	G	10: 127,742,835	N426S	probably benign	Het
Zfp184	T	A	13: 21,949,749	D55E	probably damaging	Het
Zfp882	T	C	8: 71,914,337	V336A	probably benign	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTAGTCCTCACCAATTTGGGCAC -3'
(R):5'- AGACACAGCAGTTTTATGTCCTCCG -3'

Sequencing Primer
(F):5'- TGAGGTGGCATCTTATAATAGGAG -3'
(R):5'- GGCACCCTCAAATGTGTAATG -3'

Posted On

2013-07-11