Incidental Mutation 'R0636:Ptpn6'
ID56675
Institutional Source Beutler Lab
Gene Symbol Ptpn6
Ensembl Gene ENSMUSG00000004266
Gene Nameprotein tyrosine phosphatase, non-receptor type 6
SynonymsHcph, hcp, SHP-1, Ptp1C
MMRRC Submission 038825-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.584) question?
Stock #R0636 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124720707-124738714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124725279 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 346 (H346R)
Ref Sequence ENSEMBL: ENSMUSP00000133991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004377] [ENSMUST00000112484] [ENSMUST00000171549] [ENSMUST00000174265] [ENSMUST00000174787]
Predicted Effect probably benign
Transcript: ENSMUST00000004377
AA Change: H387R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004377
Gene: ENSMUSG00000004266
AA Change: H387R

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112484
AA Change: H385R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108103
Gene: ENSMUSG00000004266
AA Change: H385R

DomainStartEndE-ValueType
SH2 2 85 4.05e-28 SMART
SH2 108 200 1.45e-29 SMART
PTPc 243 517 7.51e-131 SMART
low complexity region 569 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171549
AA Change: H387R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129124
Gene: ENSMUSG00000004266
AA Change: H387R

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172613
Predicted Effect probably benign
Transcript: ENSMUST00000172690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173228
Predicted Effect probably benign
Transcript: ENSMUST00000173315
SMART Domains Protein: ENSMUSP00000134274
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SCOP:d1eeoa_ 2 38 1e-3 SMART
PDB:3PS5|A 2 91 2e-41 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174265
AA Change: H346R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133991
Gene: ENSMUSG00000004266
AA Change: H346R

DomainStartEndE-ValueType
Pfam:SH2 1 40 3.5e-6 PFAM
SH2 69 161 1.45e-29 SMART
PTPc 204 478 7.51e-131 SMART
low complexity region 530 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174787
Meta Mutation Damage Score 0.0739 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,231,217 Y264C probably damaging Het
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Aco1 A G 4: 40,175,697 E146G probably damaging Het
Adam2 T G 14: 66,034,816 D639A probably benign Het
Adh4 G T 3: 138,428,074 R315L probably damaging Het
Adprhl1 T C 8: 13,248,702 D76G probably damaging Het
AF366264 T C 8: 13,837,870 R74G probably benign Het
Akip1 T C 7: 109,707,519 probably benign Het
Ap3d1 T A 10: 80,719,382 K370* probably null Het
Arfgef1 C A 1: 10,199,851 V358L probably benign Het
Arpp21 A T 9: 112,183,498 D85E probably benign Het
Azi2 A T 9: 118,062,057 L383F probably benign Het
Bpgm T A 6: 34,504,287 D206E probably benign Het
Bsn T C 9: 108,107,834 D3007G unknown Het
Ccdc142 T G 6: 83,107,198 probably benign Het
Cep135 T C 5: 76,615,657 V498A probably benign Het
Cntn6 A T 6: 104,863,148 Q1003L probably benign Het
Cntnap2 T A 6: 47,296,708 probably benign Het
Csf2rb2 G A 15: 78,291,960 Q139* probably null Het
Cyp3a16 A G 5: 145,463,085 V101A probably benign Het
D630045J12Rik T C 6: 38,196,778 T152A probably benign Het
Def8 G A 8: 123,454,357 W176* probably null Het
Dgkg A G 16: 22,579,729 probably benign Het
Ear10 T C 14: 43,922,994 probably null Het
Fbxw2 A T 2: 34,822,847 Y67* probably null Het
Flii T A 11: 60,715,552 Y1104F probably damaging Het
Gm973 G A 1: 59,551,144 R270K probably benign Het
Gm9833 T C 3: 10,088,783 L204P possibly damaging Het
Gnl3 T A 14: 31,017,153 K75N probably damaging Het
Gpc6 A T 14: 117,624,493 M274L probably benign Het
Ifi47 A G 11: 49,096,651 E415G possibly damaging Het
Ift57 A G 16: 49,711,896 T130A probably benign Het
Itpr2 T A 6: 146,171,412 D2373V probably damaging Het
Kat6a T C 8: 22,939,323 S1565P possibly damaging Het
Klhl6 A T 16: 19,948,073 probably benign Het
Klra2 T C 6: 131,220,104 probably benign Het
Lama5 A G 2: 180,189,331 probably null Het
Mapk4 A G 18: 73,930,454 S566P probably benign Het
Mindy4 C A 6: 55,276,585 R480S possibly damaging Het
Mterf3 T C 13: 66,922,753 probably benign Het
Mtmr2 A G 9: 13,801,913 probably null Het
Naip5 T C 13: 100,219,688 T1140A probably benign Het
Nf1 A G 11: 79,535,703 T1648A probably damaging Het
Nlk A T 11: 78,695,844 D141E probably benign Het
Noxa1 C A 2: 25,086,094 probably benign Het
Olfr1279 A G 2: 111,306,412 N69S probably benign Het
Olfr1480 A T 19: 13,530,249 Y236F possibly damaging Het
Olfr476 T C 7: 107,967,472 V25A probably benign Het
Otog G A 7: 46,264,228 probably null Het
Pebp4 T C 14: 70,048,347 probably benign Het
Phgdh G T 3: 98,333,291 N100K possibly damaging Het
Pnisr T A 4: 21,873,800 probably benign Het
Rsf1 T C 7: 97,662,019 V652A possibly damaging Het
Rubcn G A 16: 32,828,686 H624Y probably damaging Het
Setdb2 T C 14: 59,406,704 N656D probably benign Het
Slc22a23 T C 13: 34,299,093 T268A probably benign Het
Slc3a1 A T 17: 85,032,794 T215S possibly damaging Het
Srsf2 A G 11: 116,852,078 S206P probably benign Het
Susd2 T A 10: 75,639,350 D542V probably damaging Het
Svep1 G A 4: 58,073,121 Q2063* probably null Het
Syne2 G A 12: 75,930,983 V1401M possibly damaging Het
Tenm2 A G 11: 36,943,976 L64P probably damaging Het
Tigd2 A G 6: 59,211,287 T380A possibly damaging Het
Trmt12 G T 15: 58,873,985 V411F probably damaging Het
Ubr4 T C 4: 139,436,302 probably null Het
Ush2a G A 1: 188,822,738 C3571Y probably benign Het
Usp8 A G 2: 126,720,110 M75V possibly damaging Het
Vcan C T 13: 89,704,706 D712N probably damaging Het
Vcan C A 13: 89,712,267 R327L probably damaging Het
Vps8 A G 16: 21,434,933 E8G probably benign Het
Washc5 T C 15: 59,359,409 D335G probably benign Het
Zbtb39 A G 10: 127,742,835 N426S probably benign Het
Zfp184 T A 13: 21,949,749 D55E probably damaging Het
Zfp882 T C 8: 71,914,337 V336A probably benign Het
Other mutations in Ptpn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ptpn6 APN 6 124732356 unclassified probably null
IGL01490:Ptpn6 APN 6 124728344 missense probably damaging 1.00
IGL01865:Ptpn6 APN 6 124732465 missense probably damaging 1.00
IGL02017:Ptpn6 APN 6 124732486 missense probably damaging 0.98
IGL02272:Ptpn6 APN 6 124721208 missense probably damaging 0.99
IGL02276:Ptpn6 APN 6 124728865 missense probably null 1.00
IGL02556:Ptpn6 APN 6 124728660 missense probably benign 0.00
candle UTSW 6 124728419 missense probably damaging 1.00
caterpillar UTSW 6 124724984 missense probably benign
farfalla_notturna UTSW 6 124732435 missense probably damaging 1.00
Flutterby UTSW 6 124721858 missense possibly damaging 0.89
Lepidopteran UTSW 6 124728172 missense probably damaging 1.00
Naphthalene UTSW 6 124721789 missense probably benign 0.42
spin UTSW 6 124728559 missense probably damaging 1.00
spin2 UTSW 6 124732369 missense probably damaging 1.00
Vermeil UTSW 6 124732950 missense probably benign 0.10
R0183:Ptpn6 UTSW 6 124728951 missense probably damaging 1.00
R0254:Ptpn6 UTSW 6 124728150 missense probably damaging 1.00
R0835:Ptpn6 UTSW 6 124727536 critical splice acceptor site probably null
R1383:Ptpn6 UTSW 6 124721893 missense probably damaging 1.00
R1638:Ptpn6 UTSW 6 124721185 missense probably benign
R1900:Ptpn6 UTSW 6 124728933 missense probably benign 0.15
R2047:Ptpn6 UTSW 6 124721789 missense probably benign 0.42
R2143:Ptpn6 UTSW 6 124724984 missense probably benign 0.01
R3907:Ptpn6 UTSW 6 124725276 missense possibly damaging 0.86
R4082:Ptpn6 UTSW 6 124728419 missense probably damaging 1.00
R4382:Ptpn6 UTSW 6 124727398 missense possibly damaging 0.86
R5319:Ptpn6 UTSW 6 124732950 missense probably benign 0.10
R5807:Ptpn6 UTSW 6 124724984 missense probably benign
R5878:Ptpn6 UTSW 6 124728785 missense probably damaging 1.00
R6056:Ptpn6 UTSW 6 124732435 missense probably damaging 1.00
R6374:Ptpn6 UTSW 6 124732569 unclassified probably null
R7238:Ptpn6 UTSW 6 124721858 missense possibly damaging 0.89
R7381:Ptpn6 UTSW 6 124728172 missense probably damaging 1.00
Z1176:Ptpn6 UTSW 6 124725076 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTAATGTCTGCTGCTTCCACAC -3'
(R):5'- CCATCCCTCATGAATGTATCTGCACAC -3'

Sequencing Primer
(F):5'- GCTGCTTCCACACAATATCC -3'
(R):5'- atacacacaagcacaccattc -3'
Posted On2013-07-11