Incidental Mutation 'R7297:Heatr1'
ID 566762
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene Name HEAT repeat containing 1
Synonyms B130016L12Rik
MMRRC Submission 045401-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R7297 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 12410256-12453774 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 12435941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1160 (Q1160*)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270]
AlphaFold G3X9B1
Predicted Effect probably null
Transcript: ENSMUST00000059270
AA Change: Q1160*
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: Q1160*

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,332,088 (GRCm39) D1400G probably benign Het
Abca6 C T 11: 110,073,852 (GRCm39) probably null Het
Adh4 A G 3: 138,134,901 (GRCm39) I358M possibly damaging Het
Akap6 T G 12: 52,934,147 (GRCm39) D546E probably benign Het
Arap3 G A 18: 38,106,616 (GRCm39) A1409V possibly damaging Het
Arhgap22 C T 14: 32,993,890 (GRCm39) R68* probably null Het
Arhgef4 A T 1: 34,846,273 (GRCm39) D207V probably damaging Het
Asb15 A G 6: 24,566,462 (GRCm39) T472A probably damaging Het
Ascl1 A T 10: 87,328,326 (GRCm39) S209T probably damaging Het
Asxl1 T C 2: 153,239,355 (GRCm39) V382A probably benign Het
Atp11a T C 8: 12,856,774 (GRCm39) probably null Het
Calu C T 6: 29,356,554 (GRCm39) R27* probably null Het
Cdh20 A G 1: 104,898,598 (GRCm39) T442A probably benign Het
Chrm3 T A 13: 9,927,869 (GRCm39) Q389L probably benign Het
Cntnap1 A G 11: 101,079,460 (GRCm39) T1233A probably benign Het
Cwc15 G A 9: 14,421,525 (GRCm39) C197Y probably damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dennd3 C T 15: 73,429,459 (GRCm39) T914I probably damaging Het
Dlx3 C A 11: 95,011,276 (GRCm39) Y43* probably null Het
Dnah17 A T 11: 117,946,556 (GRCm39) probably null Het
Dnah17 A G 11: 117,994,182 (GRCm39) F1081S probably damaging Het
Dpp10 G A 1: 123,281,157 (GRCm39) Q631* probably null Het
Dsel T A 1: 111,789,506 (GRCm39) D343V probably damaging Het
Efcab12 T C 6: 115,787,997 (GRCm39) D655G possibly damaging Het
Epha8 T A 4: 136,673,224 (GRCm39) I187L probably damaging Het
Exosc10 A G 4: 148,664,834 (GRCm39) K781E probably damaging Het
Exosc5 T C 7: 25,365,751 (GRCm39) L200P probably benign Het
Faiml T C 9: 99,111,666 (GRCm39) E131G probably damaging Het
Gm5145 G A 17: 20,790,993 (GRCm39) V124I probably benign Het
Grm7 T C 6: 110,622,974 (GRCm39) V49A probably benign Het
Gtf2e1 T C 16: 37,356,427 (GRCm39) D35G probably damaging Het
Herc2 T A 7: 55,786,406 (GRCm39) C1584S probably benign Het
Hsd17b3 T C 13: 64,224,165 (GRCm39) I88V probably damaging Het
Hspa14 A C 2: 3,499,179 (GRCm39) L205R possibly damaging Het
Ifna11 A C 4: 88,738,662 (GRCm39) E156A possibly damaging Het
Krt87 T C 15: 101,387,528 (GRCm39) D170G probably benign Het
Mas1 T C 17: 13,060,745 (GRCm39) Y226C probably damaging Het
Micall1 T C 15: 79,005,097 (GRCm39) F190L unknown Het
Msi2 A T 11: 88,370,864 (GRCm39) L141Q probably damaging Het
Nfkbib T C 7: 28,465,768 (GRCm39) D27G probably benign Het
Nlrp9b A G 7: 19,783,438 (GRCm39) D927G possibly damaging Het
Nrg3 T C 14: 38,092,896 (GRCm39) D579G probably benign Het
Nutm1 G A 2: 112,080,401 (GRCm39) R505C probably damaging Het
Or8d1 G A 9: 38,767,245 (GRCm39) D296N probably damaging Het
Or8h6 A T 2: 86,703,980 (GRCm39) V29E probably damaging Het
Parp4 C T 14: 56,885,138 (GRCm39) P1406S not run Het
Pkib A T 10: 57,612,422 (GRCm39) Q101L possibly damaging Het
Plat C T 8: 23,265,713 (GRCm39) T252I probably benign Het
Ppm1d A T 11: 85,236,821 (GRCm39) E533D probably damaging Het
Psd3 T C 8: 68,573,686 (GRCm39) K165R probably damaging Het
Psg29 T A 7: 16,944,616 (GRCm39) Y375* probably null Het
Pus7 A T 5: 23,946,908 (GRCm39) I644N probably damaging Het
Rbbp9 A T 2: 144,385,722 (GRCm39) M181K probably benign Het
Rell1 A T 5: 64,093,418 (GRCm39) N112K possibly damaging Het
Simc1 AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG 13: 54,673,048 (GRCm39) probably benign Het
Skint5 G A 4: 113,400,131 (GRCm39) T1184M unknown Het
Slc27a2 T A 2: 126,420,866 (GRCm39) D452E probably damaging Het
Slc44a4 T A 17: 35,146,888 (GRCm39) I489N probably damaging Het
Slfn14 T A 11: 83,169,821 (GRCm39) K608* probably null Het
Snx15 T A 19: 6,170,537 (GRCm39) I301F probably damaging Het
Sost C T 11: 101,854,929 (GRCm39) G127R probably damaging Het
Stt3b A G 9: 115,106,025 (GRCm39) I150T probably damaging Het
Susd2 T C 10: 75,478,402 (GRCm39) D58G probably benign Het
Tex46 T G 4: 136,340,212 (GRCm39) V99G probably damaging Het
Tgfbi T A 13: 56,779,926 (GRCm39) F492I possibly damaging Het
Tmem132c G A 5: 127,437,281 (GRCm39) A257T probably benign Het
Trim2 A T 3: 84,117,540 (GRCm39) I51K probably damaging Het
Tsn A T 1: 118,228,591 (GRCm39) Y210* probably null Het
Umodl1 G A 17: 31,227,639 (GRCm39) R1324H probably benign Het
Utp3 G C 5: 88,702,376 (GRCm39) probably benign Het
Vmn1r5 A T 6: 56,963,204 (GRCm39) N293I possibly damaging Het
Vmn2r124 A T 17: 18,293,835 (GRCm39) I641F probably damaging Het
Vmn2r84 T C 10: 130,227,119 (GRCm39) N240D probably benign Het
Wbp1l A G 19: 46,642,839 (GRCm39) D264G possibly damaging Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12,425,331 (GRCm39) missense probably benign 0.00
IGL00863:Heatr1 APN 13 12,450,009 (GRCm39) missense probably benign 0.02
IGL00899:Heatr1 APN 13 12,450,057 (GRCm39) missense probably benign 0.31
IGL01147:Heatr1 APN 13 12,452,793 (GRCm39) missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12,413,908 (GRCm39) missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12,413,819 (GRCm39) missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12,428,409 (GRCm39) missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12,444,680 (GRCm39) missense probably benign
IGL02803:Heatr1 APN 13 12,448,867 (GRCm39) missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12,441,093 (GRCm39) missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12,430,940 (GRCm39) missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12,449,292 (GRCm39) missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12,422,390 (GRCm39) unclassified probably benign
IGL03035:Heatr1 APN 13 12,428,100 (GRCm39) splice site probably benign
IGL03301:Heatr1 APN 13 12,449,086 (GRCm39) missense probably damaging 1.00
hasan UTSW 13 12,432,328 (GRCm39) splice site probably benign
H8562:Heatr1 UTSW 13 12,423,594 (GRCm39) missense probably benign 0.13
R0226:Heatr1 UTSW 13 12,425,443 (GRCm39) missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12,445,121 (GRCm39) missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12,420,918 (GRCm39) missense probably benign 0.14
R1264:Heatr1 UTSW 13 12,439,491 (GRCm39) unclassified probably benign
R1371:Heatr1 UTSW 13 12,432,513 (GRCm39) missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12,432,328 (GRCm39) splice site probably benign
R1396:Heatr1 UTSW 13 12,420,927 (GRCm39) missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12,427,040 (GRCm39) missense probably benign
R1689:Heatr1 UTSW 13 12,439,506 (GRCm39) missense probably benign 0.00
R1696:Heatr1 UTSW 13 12,438,602 (GRCm39) missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12,411,341 (GRCm39) missense probably benign 0.01
R1859:Heatr1 UTSW 13 12,418,040 (GRCm39) missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12,450,066 (GRCm39) missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12,411,419 (GRCm39) missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12,429,359 (GRCm39) missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12,426,939 (GRCm39) missense probably benign 0.03
R2119:Heatr1 UTSW 13 12,447,527 (GRCm39) missense probably null 1.00
R2121:Heatr1 UTSW 13 12,418,145 (GRCm39) missense probably benign 0.10
R2122:Heatr1 UTSW 13 12,418,145 (GRCm39) missense probably benign 0.10
R2367:Heatr1 UTSW 13 12,448,605 (GRCm39) missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12,428,229 (GRCm39) missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12,449,341 (GRCm39) missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12,449,341 (GRCm39) missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12,449,341 (GRCm39) missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12,449,341 (GRCm39) missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12,450,002 (GRCm39) missense probably benign 0.00
R4533:Heatr1 UTSW 13 12,449,392 (GRCm39) missense probably benign 0.05
R4725:Heatr1 UTSW 13 12,439,543 (GRCm39) nonsense probably null
R4763:Heatr1 UTSW 13 12,445,811 (GRCm39) missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12,446,718 (GRCm39) missense probably benign 0.00
R4797:Heatr1 UTSW 13 12,426,929 (GRCm39) missense probably benign 0.36
R4798:Heatr1 UTSW 13 12,426,929 (GRCm39) missense probably benign 0.36
R4942:Heatr1 UTSW 13 12,428,391 (GRCm39) critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12,425,480 (GRCm39) missense probably benign 0.38
R4954:Heatr1 UTSW 13 12,422,397 (GRCm39) critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12,416,403 (GRCm39) missense probably benign 0.02
R5464:Heatr1 UTSW 13 12,448,524 (GRCm39) missense probably benign 0.00
R5483:Heatr1 UTSW 13 12,413,795 (GRCm39) missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12,435,945 (GRCm39) missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12,421,500 (GRCm39) missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12,419,829 (GRCm39) missense probably benign
R5527:Heatr1 UTSW 13 12,417,641 (GRCm39) missense probably damaging 1.00
R5836:Heatr1 UTSW 13 12,423,617 (GRCm39) missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12,449,352 (GRCm39) missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12,420,939 (GRCm39) missense probably benign 0.26
R6018:Heatr1 UTSW 13 12,419,828 (GRCm39) missense probably benign
R6216:Heatr1 UTSW 13 12,447,545 (GRCm39) missense probably benign 0.16
R6396:Heatr1 UTSW 13 12,420,978 (GRCm39) missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12,449,111 (GRCm39) missense probably benign 0.29
R6922:Heatr1 UTSW 13 12,449,956 (GRCm39) missense probably benign 0.00
R7077:Heatr1 UTSW 13 12,433,045 (GRCm39) missense possibly damaging 0.63
R7445:Heatr1 UTSW 13 12,445,919 (GRCm39) missense possibly damaging 0.70
R7669:Heatr1 UTSW 13 12,426,143 (GRCm39) missense probably benign 0.33
R7672:Heatr1 UTSW 13 12,453,545 (GRCm39) missense probably damaging 0.96
R7772:Heatr1 UTSW 13 12,432,522 (GRCm39) missense probably benign 0.03
R8205:Heatr1 UTSW 13 12,430,928 (GRCm39) missense probably benign
R8518:Heatr1 UTSW 13 12,425,415 (GRCm39) missense probably benign
R8754:Heatr1 UTSW 13 12,428,175 (GRCm39) missense probably damaging 0.99
R8874:Heatr1 UTSW 13 12,445,793 (GRCm39) missense probably damaging 1.00
R8992:Heatr1 UTSW 13 12,415,995 (GRCm39) missense probably damaging 0.98
R9045:Heatr1 UTSW 13 12,428,233 (GRCm39) missense probably benign 0.00
R9077:Heatr1 UTSW 13 12,428,247 (GRCm39) missense probably benign
R9183:Heatr1 UTSW 13 12,436,266 (GRCm39) missense probably damaging 0.99
R9186:Heatr1 UTSW 13 12,436,227 (GRCm39) missense probably damaging 1.00
R9223:Heatr1 UTSW 13 12,419,802 (GRCm39) missense probably benign 0.00
R9242:Heatr1 UTSW 13 12,448,806 (GRCm39) missense probably benign
R9267:Heatr1 UTSW 13 12,421,489 (GRCm39) missense probably damaging 1.00
R9289:Heatr1 UTSW 13 12,447,608 (GRCm39) missense probably benign 0.13
R9310:Heatr1 UTSW 13 12,453,491 (GRCm39) missense probably benign
R9312:Heatr1 UTSW 13 12,446,565 (GRCm39) missense probably benign
R9358:Heatr1 UTSW 13 12,433,087 (GRCm39) missense probably benign 0.09
R9385:Heatr1 UTSW 13 12,421,423 (GRCm39) missense probably damaging 1.00
R9530:Heatr1 UTSW 13 12,439,607 (GRCm39) missense probably damaging 1.00
R9532:Heatr1 UTSW 13 12,429,306 (GRCm39) missense possibly damaging 0.72
R9647:Heatr1 UTSW 13 12,441,679 (GRCm39) missense probably benign 0.00
R9683:Heatr1 UTSW 13 12,449,140 (GRCm39) missense probably damaging 1.00
R9695:Heatr1 UTSW 13 12,438,624 (GRCm39) missense probably damaging 1.00
RF011:Heatr1 UTSW 13 12,422,425 (GRCm39) missense probably benign 0.00
Z1176:Heatr1 UTSW 13 12,413,889 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GTTGACCTGTGCAGTGATGC -3'
(R):5'- GCAAAACTGGTGAGTATCTAGAAAC -3'

Sequencing Primer
(F):5'- GCAGTCCTGGAACTCACTATGTAG -3'
(R):5'- TGGTGAGTATCTAGAAACCACAAC -3'
Posted On 2019-06-26