Incidental Mutation 'R7297:Arhgap22'
ID 566766
Institutional Source Beutler Lab
Gene Symbol Arhgap22
Ensembl Gene ENSMUSG00000063506
Gene Name Rho GTPase activating protein 22
Synonyms RHOGAP2, B230341L19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7297 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 33214026-33369934 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 33271933 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 68 (R68*)
Ref Sequence ENSEMBL: ENSMUSP00000107587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111956] [ENSMUST00000131086]
AlphaFold Q8BL80
Predicted Effect probably null
Transcript: ENSMUST00000111956
AA Change: R68*
SMART Domains Protein: ENSMUSP00000107587
Gene: ENSMUSG00000063506
AA Change: R68*

DomainStartEndE-ValueType
PH 44 153 1.03e-24 SMART
RhoGAP 176 352 1.96e-65 SMART
low complexity region 472 483 N/A INTRINSIC
low complexity region 505 546 N/A INTRINSIC
low complexity region 553 563 N/A INTRINSIC
coiled coil region 612 691 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131086
AA Change: R62*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTPase activating protein family which activates a GTPase belonging to the RAS superfamily of small GTP-binding proteins. The encoded protein is insulin-responsive, is dependent on the kinase Akt and requires the Akt-dependent 14-3-3 binding protein which binds sequentially to two serine residues. The result of these interactions is regulation of cell motility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Abca6 C T 11: 110,183,026 probably null Het
Adh4 A G 3: 138,429,140 I358M possibly damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Arap3 G A 18: 37,973,563 A1409V possibly damaging Het
Arhgef4 A T 1: 34,807,192 D207V probably damaging Het
Asb15 A G 6: 24,566,463 T472A probably damaging Het
Ascl1 A T 10: 87,492,464 S209T probably damaging Het
Asxl1 T C 2: 153,397,435 V382A probably benign Het
Atp11a T C 8: 12,806,774 probably null Het
Calu C T 6: 29,356,555 R27* probably null Het
Cdh20 A G 1: 104,970,873 T442A probably benign Het
Chrm3 T A 13: 9,877,833 Q389L probably benign Het
Cntnap1 A G 11: 101,188,634 T1233A probably benign Het
Cwc15 G A 9: 14,510,229 C197Y probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dennd3 C T 15: 73,557,610 T914I probably damaging Het
Dlx3 C A 11: 95,120,450 Y43* probably null Het
Dnah17 A T 11: 118,055,730 probably null Het
Dnah17 A G 11: 118,103,356 F1081S probably damaging Het
Dpp10 G A 1: 123,353,428 Q631* probably null Het
Dsel T A 1: 111,861,776 D343V probably damaging Het
Efcab12 T C 6: 115,811,036 D655G possibly damaging Het
Epha8 T A 4: 136,945,913 I187L probably damaging Het
Exosc10 A G 4: 148,580,377 K781E probably damaging Het
Exosc5 T C 7: 25,666,326 L200P probably benign Het
Faiml T C 9: 99,229,613 E131G probably damaging Het
Gm13723 A T 2: 86,873,636 V29E probably damaging Het
Gm5145 G A 17: 20,570,731 V124I probably benign Het
Grm7 T C 6: 110,646,013 V49A probably benign Het
Gtf2e1 T C 16: 37,536,065 D35G probably damaging Het
Heatr1 C T 13: 12,421,060 Q1160* probably null Het
Herc2 T A 7: 56,136,658 C1584S probably benign Het
Hsd17b3 T C 13: 64,076,351 I88V probably damaging Het
Hspa14 A C 2: 3,498,142 L205R possibly damaging Het
Ifna11 A C 4: 88,820,425 E156A possibly damaging Het
Krt83 T C 15: 101,489,647 D170G probably benign Het
Mas1 T C 17: 12,841,858 Y226C probably damaging Het
Micall1 T C 15: 79,120,897 F190L unknown Het
Msi2 A T 11: 88,480,038 L141Q probably damaging Het
Nfkbib T C 7: 28,766,343 D27G probably benign Het
Nlrp9b A G 7: 20,049,513 D927G possibly damaging Het
Nrg3 T C 14: 38,370,939 D579G probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr26 G A 9: 38,855,949 D296N probably damaging Het
Parp4 C T 14: 56,647,681 P1406S not run Het
Pkib A T 10: 57,736,326 Q101L possibly damaging Het
Plat C T 8: 22,775,697 T252I probably benign Het
Ppm1d A T 11: 85,345,995 E533D probably damaging Het
Psd3 T C 8: 68,121,034 K165R probably damaging Het
Psg29 T A 7: 17,210,691 Y375* probably null Het
Pus7 A T 5: 23,741,910 I644N probably damaging Het
Rbbp9 A T 2: 144,543,802 M181K probably benign Het
Rell1 A T 5: 63,936,075 N112K possibly damaging Het
Simc1 AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG 13: 54,525,235 probably benign Het
Skint5 G A 4: 113,542,934 T1184M unknown Het
Slc27a2 T A 2: 126,578,946 D452E probably damaging Het
Slc44a4 T A 17: 34,927,912 I489N probably damaging Het
Slfn14 T A 11: 83,278,995 K608* probably null Het
Snx15 T A 19: 6,120,507 I301F probably damaging Het
Sost C T 11: 101,964,103 G127R probably damaging Het
Stt3b A G 9: 115,276,957 I150T probably damaging Het
Susd2 T C 10: 75,642,568 D58G probably benign Het
Tex46 T G 4: 136,612,901 V99G probably damaging Het
Tgfbi T A 13: 56,632,113 F492I possibly damaging Het
Tmem132c G A 5: 127,360,217 A257T probably benign Het
Trim2 A T 3: 84,210,233 I51K probably damaging Het
Tsn A T 1: 118,300,861 Y210* probably null Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r5 A T 6: 56,986,219 N293I possibly damaging Het
Vmn2r124 A T 17: 18,073,573 I641F probably damaging Het
Vmn2r84 T C 10: 130,391,250 N240D probably benign Het
Wbp1l A G 19: 46,654,400 D264G possibly damaging Het
Other mutations in Arhgap22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Arhgap22 APN 14 33359273 missense probably damaging 1.00
IGL02707:Arhgap22 APN 14 33363272 splice site probably benign
R0329:Arhgap22 UTSW 14 33369417 missense possibly damaging 0.55
R0330:Arhgap22 UTSW 14 33369417 missense possibly damaging 0.55
R0335:Arhgap22 UTSW 14 33359108 splice site probably benign
R0625:Arhgap22 UTSW 14 33366714 missense probably benign 0.01
R0961:Arhgap22 UTSW 14 33367113 missense probably damaging 0.98
R1167:Arhgap22 UTSW 14 33343307 splice site probably null
R1991:Arhgap22 UTSW 14 33366959 missense probably damaging 0.98
R3820:Arhgap22 UTSW 14 33367421 missense probably benign 0.41
R4377:Arhgap22 UTSW 14 33369510 missense probably damaging 0.99
R4670:Arhgap22 UTSW 14 33362543 missense probably damaging 1.00
R4671:Arhgap22 UTSW 14 33362543 missense probably damaging 1.00
R5177:Arhgap22 UTSW 14 33366693 missense probably benign 0.09
R5910:Arhgap22 UTSW 14 33366615 missense probably damaging 0.98
R7868:Arhgap22 UTSW 14 33364516 unclassified probably benign
R8128:Arhgap22 UTSW 14 33367085 missense probably benign 0.00
R8900:Arhgap22 UTSW 14 33271923 nonsense probably null
R9486:Arhgap22 UTSW 14 33351346 missense probably benign 0.04
Z1176:Arhgap22 UTSW 14 33362522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGGCTACTGACCTGATTCTC -3'
(R):5'- CATTTCGGAAGTCGGAGGTG -3'

Sequencing Primer
(F):5'- GGCTACTGACCTGATTCTCCACAC -3'
(R):5'- TGTTTAGAAAAACGGGCTGTGATATG -3'
Posted On 2019-06-26