Mutagenetix > Incidental Mutation

Incidental Mutation 'R7297:Umodl1'

566776

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7297 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 31008665 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 1324 (R1324H)

Ref Sequence

ENSEMBL: ENSMUSP00000110202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

probably benign
Transcript: ENSMUST00000066554
AA Change: R1324H

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: R1324H

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000066981
AA Change: R1209H

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: R1209H

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114555
AA Change: R1324H

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: R1324H

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	A	G	2: 25,442,076	D1400G	probably benign	Het
Abca6	C	T	11: 110,183,026		probably null	Het
Adh4	A	G	3: 138,429,140	I358M	possibly damaging	Het
Akap6	T	G	12: 52,887,364	D546E	probably benign	Het
Arap3	G	A	18: 37,973,563	A1409V	possibly damaging	Het
Arhgap22	C	T	14: 33,271,933	R68*	probably null	Het
Arhgef4	A	T	1: 34,807,192	D207V	probably damaging	Het
Asb15	A	G	6: 24,566,463	T472A	probably damaging	Het
Ascl1	A	T	10: 87,492,464	S209T	probably damaging	Het
Asxl1	T	C	2: 153,397,435	V382A	probably benign	Het
Atp11a	T	C	8: 12,806,774		probably null	Het
Calu	C	T	6: 29,356,555	R27*	probably null	Het
Cdh20	A	G	1: 104,970,873	T442A	probably benign	Het
Chrm3	T	A	13: 9,877,833	Q389L	probably benign	Het
Cntnap1	A	G	11: 101,188,634	T1233A	probably benign	Het
Cwc15	G	A	9: 14,510,229	C197Y	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dennd3	C	T	15: 73,557,610	T914I	probably damaging	Het
Dlx3	C	A	11: 95,120,450	Y43*	probably null	Het
Dnah17	A	T	11: 118,055,730		probably null	Het
Dnah17	A	G	11: 118,103,356	F1081S	probably damaging	Het
Dpp10	G	A	1: 123,353,428	Q631*	probably null	Het
Dsel	T	A	1: 111,861,776	D343V	probably damaging	Het
Efcab12	T	C	6: 115,811,036	D655G	possibly damaging	Het
Epha8	T	A	4: 136,945,913	I187L	probably damaging	Het
Exosc10	A	G	4: 148,580,377	K781E	probably damaging	Het
Exosc5	T	C	7: 25,666,326	L200P	probably benign	Het
Faiml	T	C	9: 99,229,613	E131G	probably damaging	Het
Gm13723	A	T	2: 86,873,636	V29E	probably damaging	Het
Gm5145	G	A	17: 20,570,731	V124I	probably benign	Het
Grm7	T	C	6: 110,646,013	V49A	probably benign	Het
Gtf2e1	T	C	16: 37,536,065	D35G	probably damaging	Het
Heatr1	C	T	13: 12,421,060	Q1160*	probably null	Het
Herc2	T	A	7: 56,136,658	C1584S	probably benign	Het
Hsd17b3	T	C	13: 64,076,351	I88V	probably damaging	Het
Hspa14	A	C	2: 3,498,142	L205R	possibly damaging	Het
Ifna11	A	C	4: 88,820,425	E156A	possibly damaging	Het
Krt83	T	C	15: 101,489,647	D170G	probably benign	Het
Mas1	T	C	17: 12,841,858	Y226C	probably damaging	Het
Micall1	T	C	15: 79,120,897	F190L	unknown	Het
Msi2	A	T	11: 88,480,038	L141Q	probably damaging	Het
Nfkbib	T	C	7: 28,766,343	D27G	probably benign	Het
Nlrp9b	A	G	7: 20,049,513	D927G	possibly damaging	Het
Nrg3	T	C	14: 38,370,939	D579G	probably benign	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr26	G	A	9: 38,855,949	D296N	probably damaging	Het
Parp4	C	T	14: 56,647,681	P1406S	not run	Het
Pkib	A	T	10: 57,736,326	Q101L	possibly damaging	Het
Plat	C	T	8: 22,775,697	T252I	probably benign	Het
Ppm1d	A	T	11: 85,345,995	E533D	probably damaging	Het
Psd3	T	C	8: 68,121,034	K165R	probably damaging	Het
Psg29	T	A	7: 17,210,691	Y375*	probably null	Het
Pus7	A	T	5: 23,741,910	I644N	probably damaging	Het
Rbbp9	A	T	2: 144,543,802	M181K	probably benign	Het
Rell1	A	T	5: 63,936,075	N112K	possibly damaging	Het
Simc1	AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG	AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG	13: 54,525,235		probably benign	Het
Skint5	G	A	4: 113,542,934	T1184M	unknown	Het
Slc27a2	T	A	2: 126,578,946	D452E	probably damaging	Het
Slc44a4	T	A	17: 34,927,912	I489N	probably damaging	Het
Slfn14	T	A	11: 83,278,995	K608*	probably null	Het
Snx15	T	A	19: 6,120,507	I301F	probably damaging	Het
Sost	C	T	11: 101,964,103	G127R	probably damaging	Het
Stt3b	A	G	9: 115,276,957	I150T	probably damaging	Het
Susd2	T	C	10: 75,642,568	D58G	probably benign	Het
Tex46	T	G	4: 136,612,901	V99G	probably damaging	Het
Tgfbi	T	A	13: 56,632,113	F492I	possibly damaging	Het
Tmem132c	G	A	5: 127,360,217	A257T	probably benign	Het
Trim2	A	T	3: 84,210,233	I51K	probably damaging	Het
Tsn	A	T	1: 118,300,861	Y210*	probably null	Het
Utp3	G	C	5: 88,554,517		probably benign	Het
Vmn1r5	A	T	6: 56,986,219	N293I	possibly damaging	Het
Vmn2r124	A	T	17: 18,073,573	I641F	probably damaging	Het
Vmn2r84	T	C	10: 130,391,250	N240D	probably benign	Het
Wbp1l	A	G	19: 46,654,400	D264G	possibly damaging	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
Disquieting	UTSW	17	30959155	missense	probably damaging	1.00
floored	UTSW	17	30988057	nonsense	probably null
R7231_umodl1_507	UTSW	17	30986116	missense	probably damaging	1.00
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
G1citation:Umodl1	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30982258	splice site	probably benign
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7594:Umodl1	UTSW	17	30954805	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	30986387	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	30983984	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	30973703	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	30959173	missense	probably benign	0.01
R9270:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	30996393	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	30998169	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	30998178	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	30959350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATAATTCCCCTGACCCTGAC -3'
(R):5'- ACAGTTCTCAGCCACTCTGG -3'

Sequencing Primer
(F):5'- TGACACCTCTCTTACCCTGAAAC -3'
(R):5'- GAGGTTTGTCAGTTACAGATCTACCC -3'

Posted On

2019-06-26