Incidental Mutation 'R7298:Zgrf1'
ID566788
Institutional Source Beutler Lab
Gene Symbol Zgrf1
Ensembl Gene ENSMUSG00000051278
Gene Namezinc finger, GRF-type containing 1
Synonyms4930422G04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7298 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location127553489-127618023 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 127583650 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 848 (S848*)
Ref Sequence ENSEMBL: ENSMUSP00000044432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043108] [ENSMUST00000196141] [ENSMUST00000196341] [ENSMUST00000199888] [ENSMUST00000200490]
Predicted Effect probably null
Transcript: ENSMUST00000043108
AA Change: S848*
SMART Domains Protein: ENSMUSP00000044432
Gene: ENSMUSG00000051278
AA Change: S848*

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196141
AA Change: S848*
SMART Domains Protein: ENSMUSP00000143761
Gene: ENSMUSG00000051278
AA Change: S848*

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196341
SMART Domains Protein: ENSMUSP00000143570
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Pfam:zf-GRF 225 269 6.7e-15 PFAM
low complexity region 432 444 N/A INTRINSIC
Pfam:AAA_11 491 659 7.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199888
SMART Domains Protein: ENSMUSP00000142693
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 82 3.5e-22 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200490
SMART Domains Protein: ENSMUSP00000143585
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.4e-20 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,883 T51S probably benign Het
Abcc1 A G 16: 14,396,472 D204G possibly damaging Het
Acaa1b C T 9: 119,151,847 E172K probably benign Het
Adamts5 G A 16: 85,899,918 T117I probably benign Het
Agmat A G 4: 141,746,964 E52G possibly damaging Het
Alg9 C T 9: 50,779,061 A121V probably damaging Het
Atf7ip2 T C 16: 10,209,168 I100T possibly damaging Het
Calm2 T C 17: 87,442,737 probably null Het
Cfap44 A T 16: 44,481,412 M1838L probably benign Het
Cym A G 3: 107,219,693 Y49H probably benign Het
Dchs1 G A 7: 105,755,131 R2735* probably null Het
Dnajc6 T C 4: 101,606,611 I187T probably benign Het
Fam151a G T 4: 106,735,528 R69L possibly damaging Het
Gm13089 C A 4: 143,698,505 D123Y probably benign Het
Gm14548 T A 7: 3,895,265 I353F possibly damaging Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm9922 C A 14: 101,729,525 G97V unknown Het
Hacl1 A T 14: 31,616,486 M378K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-82 A T 12: 115,952,954 I6N possibly damaging Het
Kctd19 A C 8: 105,382,984 V942G probably benign Het
Lce1l C T 3: 92,850,176 C125Y unknown Het
Mmp8 T C 9: 7,560,448 F42S probably damaging Het
Myom2 T C 8: 15,098,411 L529P probably damaging Het
Nectin3 A T 16: 46,448,396 Y548N probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1255 T C 2: 89,816,521 F59S probably damaging Het
Olfr303 T A 7: 86,394,923 T192S probably damaging Het
Otof T A 5: 30,388,270 I514F probably damaging Het
Plch1 G T 3: 63,716,037 S603* probably null Het
Ppa1 T A 10: 61,666,912 D171E probably benign Het
Prss34 T C 17: 25,299,763 C240R probably damaging Het
Ptpre A G 7: 135,683,287 D714G probably damaging Het
Ranbp9 A G 13: 43,480,460 F157L probably benign Het
Rbbp6 A G 7: 123,001,194 K1475E unknown Het
Retnlg A G 16: 48,872,874 N5D probably benign Het
Rev1 T C 1: 38,053,104 T1245A probably damaging Het
Rngtt G T 4: 33,362,927 L360F probably damaging Het
Scrib A C 15: 76,064,761 V447G probably damaging Het
Slc22a6 C A 19: 8,621,320 A247E possibly damaging Het
Slc25a20 G A 9: 108,662,144 probably benign Het
Spag16 T A 1: 69,919,426 probably null Het
Stx3 C T 19: 11,790,048 W87* probably null Het
Syngap1 T A 17: 26,962,987 M1158K possibly damaging Het
Tmed9 C A 13: 55,593,294 H41N possibly damaging Het
Trav15-2-dv6-2 G A 14: 53,649,785 S54N probably benign Het
Tyk2 C T 9: 21,108,860 V1001I probably benign Het
Ugt8a A G 3: 125,915,416 V15A probably benign Het
Uhrf2 A G 19: 30,088,549 E661G probably benign Het
Vmn2r77 T A 7: 86,800,771 I75N probably benign Het
Zfp346 T G 13: 55,130,603 V258G probably damaging Het
Zfp72 T A 13: 74,372,394 K188N possibly damaging Het
Other mutations in Zgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Zgrf1 APN 3 127588141 splice site probably benign
IGL01153:Zgrf1 APN 3 127602406 missense probably damaging 1.00
IGL01330:Zgrf1 APN 3 127584007 missense probably damaging 1.00
IGL01501:Zgrf1 APN 3 127602562 splice site probably null
IGL01827:Zgrf1 APN 3 127616281 missense probably benign 0.06
IGL02600:Zgrf1 APN 3 127600974 splice site probably benign
IGL03122:Zgrf1 APN 3 127588133 missense possibly damaging 0.91
IGL03365:Zgrf1 APN 3 127598774 missense possibly damaging 0.48
R0015:Zgrf1 UTSW 3 127555397 splice site probably benign
R0243:Zgrf1 UTSW 3 127615446 missense probably damaging 0.99
R0468:Zgrf1 UTSW 3 127562041 missense possibly damaging 0.72
R0497:Zgrf1 UTSW 3 127584650 splice site probably benign
R0505:Zgrf1 UTSW 3 127573238 missense probably benign 0.30
R0511:Zgrf1 UTSW 3 127584660 missense possibly damaging 0.93
R0539:Zgrf1 UTSW 3 127615192 missense probably damaging 1.00
R0617:Zgrf1 UTSW 3 127588038 missense probably benign 0.39
R1298:Zgrf1 UTSW 3 127583889 missense possibly damaging 0.95
R1353:Zgrf1 UTSW 3 127611803 missense probably damaging 1.00
R1593:Zgrf1 UTSW 3 127561026 missense possibly damaging 0.86
R1846:Zgrf1 UTSW 3 127615463 missense probably damaging 1.00
R1912:Zgrf1 UTSW 3 127563137 missense probably benign
R2062:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2064:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2065:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2066:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2067:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2256:Zgrf1 UTSW 3 127561997 missense probably benign 0.18
R2321:Zgrf1 UTSW 3 127562407 nonsense probably null
R2381:Zgrf1 UTSW 3 127556214 missense probably benign 0.02
R2913:Zgrf1 UTSW 3 127598707 missense possibly damaging 0.65
R3147:Zgrf1 UTSW 3 127584148 missense possibly damaging 0.84
R3236:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R3237:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R4433:Zgrf1 UTSW 3 127562078 missense probably benign
R4441:Zgrf1 UTSW 3 127586137 missense possibly damaging 0.45
R4457:Zgrf1 UTSW 3 127595929 missense probably damaging 1.00
R4498:Zgrf1 UTSW 3 127586100 nonsense probably null
R4598:Zgrf1 UTSW 3 127601030 missense probably benign 0.14
R4701:Zgrf1 UTSW 3 127598704 missense probably benign 0.03
R4898:Zgrf1 UTSW 3 127602436 missense probably damaging 1.00
R4944:Zgrf1 UTSW 3 127561868 nonsense probably null
R5256:Zgrf1 UTSW 3 127602445 missense probably damaging 1.00
R5294:Zgrf1 UTSW 3 127600980 missense probably benign 0.14
R5358:Zgrf1 UTSW 3 127567703 critical splice donor site probably null
R5359:Zgrf1 UTSW 3 127601165 missense possibly damaging 0.95
R5447:Zgrf1 UTSW 3 127563119 missense possibly damaging 0.73
R5569:Zgrf1 UTSW 3 127561025 missense probably benign 0.33
R5887:Zgrf1 UTSW 3 127584765 missense probably damaging 1.00
R5914:Zgrf1 UTSW 3 127561023 missense probably damaging 0.99
R5925:Zgrf1 UTSW 3 127573204 missense possibly damaging 0.84
R5936:Zgrf1 UTSW 3 127562253 missense possibly damaging 0.72
R6087:Zgrf1 UTSW 3 127615486 missense probably damaging 1.00
R6089:Zgrf1 UTSW 3 127595993 missense probably damaging 1.00
R6181:Zgrf1 UTSW 3 127587941 missense probably damaging 1.00
R6277:Zgrf1 UTSW 3 127598812 missense possibly damaging 0.81
R6441:Zgrf1 UTSW 3 127588034 missense possibly damaging 0.93
R6659:Zgrf1 UTSW 3 127616506 missense probably damaging 0.99
R6857:Zgrf1 UTSW 3 127581447 missense probably damaging 0.99
R6932:Zgrf1 UTSW 3 127559632 critical splice donor site probably null
R7008:Zgrf1 UTSW 3 127561772 missense probably benign 0.18
R7175:Zgrf1 UTSW 3 127563590 missense probably damaging 1.00
R7264:Zgrf1 UTSW 3 127563569 missense probably benign 0.00
R7272:Zgrf1 UTSW 3 127598760 missense probably damaging 0.99
R7412:Zgrf1 UTSW 3 127563071 missense probably benign 0.06
R7836:Zgrf1 UTSW 3 127563431 missense probably damaging 0.96
R7919:Zgrf1 UTSW 3 127563431 missense probably damaging 0.96
R7996:Zgrf1 UTSW 3 127595924 missense possibly damaging 0.94
RF015:Zgrf1 UTSW 3 127563233 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTACTTTGTGAGGGAGCTAGAGAC -3'
(R):5'- AGTGAAACACCTCCTGGAGTC -3'

Sequencing Primer
(F):5'- GGGAGCTAGAGACTTACATTATTTTC -3'
(R):5'- TCCTGGAGTCCCACCCTG -3'
Posted On2019-06-26