Incidental Mutation 'R7298:Rbbp6'
ID566801
Institutional Source Beutler Lab
Gene Symbol Rbbp6
Ensembl Gene ENSMUSG00000030779
Gene Nameretinoblastoma binding protein 6, ubiquitin ligase
SynonymsC030034J04Rik, 4933422O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7298 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location122965686-123002557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123001194 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1475 (K1475E)
Ref Sequence ENSEMBL: ENSMUSP00000049528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052135] [ENSMUST00000071590] [ENSMUST00000205495] [ENSMUST00000231323]
Predicted Effect unknown
Transcript: ENSMUST00000052135
AA Change: K1475E
SMART Domains Protein: ENSMUSP00000049528
Gene: ENSMUSG00000030779
AA Change: K1475E

DomainStartEndE-ValueType
DWNN 4 76 3.92e-42 SMART
low complexity region 101 110 N/A INTRINSIC
ZnF_C2HC 161 177 5.67e-5 SMART
low complexity region 233 259 N/A INTRINSIC
RING 260 300 6.05e-4 SMART
low complexity region 338 349 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 551 610 N/A INTRINSIC
coiled coil region 653 679 N/A INTRINSIC
low complexity region 680 774 N/A INTRINSIC
low complexity region 824 844 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
internal_repeat_2 1026 1091 4.38e-6 PROSPERO
internal_repeat_1 1038 1107 3.76e-7 PROSPERO
low complexity region 1120 1141 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1247 1258 N/A INTRINSIC
internal_repeat_2 1395 1466 4.38e-6 PROSPERO
low complexity region 1472 1490 N/A INTRINSIC
internal_repeat_1 1523 1586 3.76e-7 PROSPERO
low complexity region 1689 1752 N/A INTRINSIC
low complexity region 1758 1784 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000071590
AA Change: K1441E
SMART Domains Protein: ENSMUSP00000071519
Gene: ENSMUSG00000030779
AA Change: K1441E

DomainStartEndE-ValueType
DWNN 4 76 3.92e-42 SMART
low complexity region 101 110 N/A INTRINSIC
ZnF_C2HC 161 177 5.67e-5 SMART
low complexity region 233 259 N/A INTRINSIC
RING 260 300 6.05e-4 SMART
low complexity region 338 349 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 551 610 N/A INTRINSIC
low complexity region 653 740 N/A INTRINSIC
low complexity region 790 810 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
low complexity region 969 991 N/A INTRINSIC
internal_repeat_2 992 1057 5.65e-6 PROSPERO
internal_repeat_1 1004 1073 5.01e-7 PROSPERO
low complexity region 1086 1107 N/A INTRINSIC
low complexity region 1109 1120 N/A INTRINSIC
low complexity region 1213 1224 N/A INTRINSIC
internal_repeat_2 1361 1432 5.65e-6 PROSPERO
low complexity region 1438 1456 N/A INTRINSIC
internal_repeat_1 1489 1552 5.01e-7 PROSPERO
low complexity region 1655 1718 N/A INTRINSIC
low complexity region 1724 1750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205495
Predicted Effect unknown
Transcript: ENSMUST00000231323
AA Change: K1513E
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The retinoblastoma tumor suppressor (pRB) protein binds with many other proteins. In various human cancers, pRB suppresses cellular proliferation and is inactivated. Cell cycle-dependent phosphorylation regulates the activity of pRB. This gene encodes a protein which binds to underphosphorylated but not phosphorylated pRB. Multiple alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, reduced size, growth retardation and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,883 T51S probably benign Het
Abcc1 A G 16: 14,396,472 D204G possibly damaging Het
Acaa1b C T 9: 119,151,847 E172K probably benign Het
Adamts5 G A 16: 85,899,918 T117I probably benign Het
Agmat A G 4: 141,746,964 E52G possibly damaging Het
Alg9 C T 9: 50,779,061 A121V probably damaging Het
Atf7ip2 T C 16: 10,209,168 I100T possibly damaging Het
Calm2 T C 17: 87,442,737 probably null Het
Cfap44 A T 16: 44,481,412 M1838L probably benign Het
Cym A G 3: 107,219,693 Y49H probably benign Het
Dchs1 G A 7: 105,755,131 R2735* probably null Het
Dnajc6 T C 4: 101,606,611 I187T probably benign Het
Fam151a G T 4: 106,735,528 R69L possibly damaging Het
Gm13089 C A 4: 143,698,505 D123Y probably benign Het
Gm14548 T A 7: 3,895,265 I353F possibly damaging Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm9922 C A 14: 101,729,525 G97V unknown Het
Hacl1 A T 14: 31,616,486 M378K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-82 A T 12: 115,952,954 I6N possibly damaging Het
Kctd19 A C 8: 105,382,984 V942G probably benign Het
Lce1l C T 3: 92,850,176 C125Y unknown Het
Mmp8 T C 9: 7,560,448 F42S probably damaging Het
Myom2 T C 8: 15,098,411 L529P probably damaging Het
Nectin3 A T 16: 46,448,396 Y548N probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1255 T C 2: 89,816,521 F59S probably damaging Het
Olfr303 T A 7: 86,394,923 T192S probably damaging Het
Otof T A 5: 30,388,270 I514F probably damaging Het
Plch1 G T 3: 63,716,037 S603* probably null Het
Ppa1 T A 10: 61,666,912 D171E probably benign Het
Prss34 T C 17: 25,299,763 C240R probably damaging Het
Ptpre A G 7: 135,683,287 D714G probably damaging Het
Ranbp9 A G 13: 43,480,460 F157L probably benign Het
Retnlg A G 16: 48,872,874 N5D probably benign Het
Rev1 T C 1: 38,053,104 T1245A probably damaging Het
Rngtt G T 4: 33,362,927 L360F probably damaging Het
Scrib A C 15: 76,064,761 V447G probably damaging Het
Slc22a6 C A 19: 8,621,320 A247E possibly damaging Het
Slc25a20 G A 9: 108,662,144 probably benign Het
Spag16 T A 1: 69,919,426 probably null Het
Stx3 C T 19: 11,790,048 W87* probably null Het
Syngap1 T A 17: 26,962,987 M1158K possibly damaging Het
Tmed9 C A 13: 55,593,294 H41N possibly damaging Het
Trav15-2-dv6-2 G A 14: 53,649,785 S54N probably benign Het
Tyk2 C T 9: 21,108,860 V1001I probably benign Het
Ugt8a A G 3: 125,915,416 V15A probably benign Het
Uhrf2 A G 19: 30,088,549 E661G probably benign Het
Vmn2r77 T A 7: 86,800,771 I75N probably benign Het
Zfp346 T G 13: 55,130,603 V258G probably damaging Het
Zfp72 T A 13: 74,372,394 K188N possibly damaging Het
Zgrf1 C A 3: 127,583,650 S848* probably null Het
Other mutations in Rbbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Rbbp6 APN 7 122988685 missense probably damaging 1.00
IGL00561:Rbbp6 APN 7 122971063 missense probably damaging 1.00
IGL01144:Rbbp6 APN 7 122975946 missense possibly damaging 0.95
IGL01325:Rbbp6 APN 7 122988618 missense probably damaging 1.00
IGL01520:Rbbp6 APN 7 122985675 missense possibly damaging 0.93
IGL01765:Rbbp6 APN 7 122999954 unclassified probably benign
IGL01985:Rbbp6 APN 7 122971073 missense probably damaging 1.00
IGL02094:Rbbp6 APN 7 122997262 missense probably damaging 1.00
IGL02125:Rbbp6 APN 7 122971129 critical splice donor site probably null
IGL02552:Rbbp6 APN 7 122982981 missense probably damaging 0.98
IGL02805:Rbbp6 APN 7 123001188 utr 3 prime probably benign
changeling UTSW 7 122997311 splice site probably null
Puzzlewit UTSW 7 122999808 unclassified probably benign
R0403:Rbbp6 UTSW 7 122992296 missense probably damaging 0.99
R0855:Rbbp6 UTSW 7 122992248 missense probably benign 0.22
R1132:Rbbp6 UTSW 7 123000113 unclassified probably benign
R1463:Rbbp6 UTSW 7 122992453 missense possibly damaging 0.89
R1867:Rbbp6 UTSW 7 122997029 missense probably damaging 1.00
R1957:Rbbp6 UTSW 7 122990288 missense probably benign 0.04
R1958:Rbbp6 UTSW 7 123001945 unclassified probably benign
R1978:Rbbp6 UTSW 7 122999488 unclassified probably benign
R1999:Rbbp6 UTSW 7 122990352 missense probably damaging 0.98
R2164:Rbbp6 UTSW 7 122999474 unclassified probably benign
R4181:Rbbp6 UTSW 7 122994735 missense probably damaging 0.99
R4387:Rbbp6 UTSW 7 122997311 splice site probably null
R4583:Rbbp6 UTSW 7 123001952 unclassified probably benign
R4936:Rbbp6 UTSW 7 122999703 unclassified probably benign
R4974:Rbbp6 UTSW 7 122999808 unclassified probably benign
R4998:Rbbp6 UTSW 7 122990326 missense probably benign 0.36
R5082:Rbbp6 UTSW 7 123000702 utr 3 prime probably benign
R5502:Rbbp6 UTSW 7 122988724 missense probably damaging 1.00
R5567:Rbbp6 UTSW 7 123001834 utr 3 prime probably benign
R5570:Rbbp6 UTSW 7 123001834 utr 3 prime probably benign
R5607:Rbbp6 UTSW 7 122997086 missense probably damaging 1.00
R5608:Rbbp6 UTSW 7 122997086 missense probably damaging 1.00
R5948:Rbbp6 UTSW 7 122997628 missense probably damaging 1.00
R6134:Rbbp6 UTSW 7 122997311 splice site probably null
R6172:Rbbp6 UTSW 7 122998555 nonsense probably null
R6773:Rbbp6 UTSW 7 122999355 unclassified probably benign
R6800:Rbbp6 UTSW 7 122985064 missense possibly damaging 0.93
R7266:Rbbp6 UTSW 7 123001367 missense unknown
R7535:Rbbp6 UTSW 7 122990143 missense probably benign 0.00
R7635:Rbbp6 UTSW 7 122976008 missense possibly damaging 0.80
R7665:Rbbp6 UTSW 7 122994686 missense possibly damaging 0.81
R7665:Rbbp6 UTSW 7 122990032 splice site probably null
R7910:Rbbp6 UTSW 7 122997028 missense possibly damaging 0.48
R7991:Rbbp6 UTSW 7 122997028 missense possibly damaging 0.48
R8043:Rbbp6 UTSW 7 122985245 missense probably damaging 1.00
X0062:Rbbp6 UTSW 7 123000146 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACTGCAGAAGCTTCCCAAGG -3'
(R):5'- CACATGGGCGTTTAGTTTCG -3'

Sequencing Primer
(F):5'- TCAAAGGGCAGTGCGTC -3'
(R):5'- AGGGGGCTTTATGATCATGAGGC -3'
Posted On2019-06-26