Incidental Mutation 'R7298:Ranbp9'
ID566812
Institutional Source Beutler Lab
Gene Symbol Ranbp9
Ensembl Gene ENSMUSG00000038546
Gene NameRAN binding protein 9
SynonymsRanBPM, IBAP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R7298 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location43402675-43481282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43480460 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 157 (F157L)
Ref Sequence ENSEMBL: ENSMUSP00000130636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144326] [ENSMUST00000222023] [ENSMUST00000222651]
Predicted Effect probably benign
Transcript: ENSMUST00000144326
AA Change: F157L

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130636
Gene: ENSMUSG00000038546
AA Change: F157L

DomainStartEndE-ValueType
low complexity region 2 114 N/A INTRINSIC
SPRY 194 315 1.66e-43 SMART
LisH 347 379 6.82e-5 SMART
CTLH 385 442 9.78e-15 SMART
low complexity region 455 478 N/A INTRINSIC
CRA 596 698 1.6e-24 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000222023
Predicted Effect probably benign
Transcript: ENSMUST00000222651
Meta Mutation Damage Score 0.0799 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RAN, a small GTP binding protein belonging to the RAS superfamily that is essential for the translocation of RNA and proteins through the nuclear pore complex. The protein encoded by this gene has also been shown to interact with several other proteins, including met proto-oncogene, homeodomain interacting protein kinase 2, androgen receptor, and cyclin-dependent kinase 11. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial neonatal lethality. Survivors display infertility with impaired spermatogenesis and oogenesis, azoospermia and premature ovarian failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,883 T51S probably benign Het
Abcc1 A G 16: 14,396,472 D204G possibly damaging Het
Acaa1b C T 9: 119,151,847 E172K probably benign Het
Adamts5 G A 16: 85,899,918 T117I probably benign Het
Agmat A G 4: 141,746,964 E52G possibly damaging Het
Alg9 C T 9: 50,779,061 A121V probably damaging Het
Atf7ip2 T C 16: 10,209,168 I100T possibly damaging Het
Calm2 T C 17: 87,442,737 probably null Het
Cfap44 A T 16: 44,481,412 M1838L probably benign Het
Cym A G 3: 107,219,693 Y49H probably benign Het
Dchs1 G A 7: 105,755,131 R2735* probably null Het
Dnajc6 T C 4: 101,606,611 I187T probably benign Het
Fam151a G T 4: 106,735,528 R69L possibly damaging Het
Gm13089 C A 4: 143,698,505 D123Y probably benign Het
Gm14548 T A 7: 3,895,265 I353F possibly damaging Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm9922 C A 14: 101,729,525 G97V unknown Het
Hacl1 A T 14: 31,616,486 M378K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-82 A T 12: 115,952,954 I6N possibly damaging Het
Kctd19 A C 8: 105,382,984 V942G probably benign Het
Lce1l C T 3: 92,850,176 C125Y unknown Het
Mmp8 T C 9: 7,560,448 F42S probably damaging Het
Myom2 T C 8: 15,098,411 L529P probably damaging Het
Nectin3 A T 16: 46,448,396 Y548N probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1255 T C 2: 89,816,521 F59S probably damaging Het
Olfr303 T A 7: 86,394,923 T192S probably damaging Het
Otof T A 5: 30,388,270 I514F probably damaging Het
Plch1 G T 3: 63,716,037 S603* probably null Het
Ppa1 T A 10: 61,666,912 D171E probably benign Het
Prss34 T C 17: 25,299,763 C240R probably damaging Het
Ptpre A G 7: 135,683,287 D714G probably damaging Het
Rbbp6 A G 7: 123,001,194 K1475E unknown Het
Retnlg A G 16: 48,872,874 N5D probably benign Het
Rev1 T C 1: 38,053,104 T1245A probably damaging Het
Rngtt G T 4: 33,362,927 L360F probably damaging Het
Scrib A C 15: 76,064,761 V447G probably damaging Het
Slc22a6 C A 19: 8,621,320 A247E possibly damaging Het
Slc25a20 G A 9: 108,662,144 probably benign Het
Spag16 T A 1: 69,919,426 probably null Het
Stx3 C T 19: 11,790,048 W87* probably null Het
Syngap1 T A 17: 26,962,987 M1158K possibly damaging Het
Tmed9 C A 13: 55,593,294 H41N possibly damaging Het
Trav15-2-dv6-2 G A 14: 53,649,785 S54N probably benign Het
Tyk2 C T 9: 21,108,860 V1001I probably benign Het
Ugt8a A G 3: 125,915,416 V15A probably benign Het
Uhrf2 A G 19: 30,088,549 E661G probably benign Het
Vmn2r77 T A 7: 86,800,771 I75N probably benign Het
Zfp346 T G 13: 55,130,603 V258G probably damaging Het
Zfp72 T A 13: 74,372,394 K188N possibly damaging Het
Zgrf1 C A 3: 127,583,650 S848* probably null Het
Other mutations in Ranbp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Ranbp9 APN 13 43480504 missense probably damaging 1.00
IGL01478:Ranbp9 APN 13 43414084 missense probably benign 0.31
IGL01948:Ranbp9 APN 13 43422553 missense probably damaging 1.00
IGL02177:Ranbp9 APN 13 43419717 missense probably damaging 0.99
IGL02382:Ranbp9 APN 13 43436146 splice site probably null
R0183:Ranbp9 UTSW 13 43425123 missense probably damaging 1.00
R0401:Ranbp9 UTSW 13 43422658 missense probably damaging 1.00
R0771:Ranbp9 UTSW 13 43461773 missense possibly damaging 0.92
R1551:Ranbp9 UTSW 13 43425117 missense probably benign 0.15
R1644:Ranbp9 UTSW 13 43412539 missense probably damaging 1.00
R1892:Ranbp9 UTSW 13 43416457 missense possibly damaging 0.87
R2247:Ranbp9 UTSW 13 43412425 missense probably damaging 1.00
R4097:Ranbp9 UTSW 13 43421257 missense probably damaging 0.97
R4794:Ranbp9 UTSW 13 43414076 missense probably damaging 0.99
R4908:Ranbp9 UTSW 13 43421257 missense possibly damaging 0.81
R4996:Ranbp9 UTSW 13 43425094 nonsense probably null
R5024:Ranbp9 UTSW 13 43434855 missense probably damaging 0.99
R5422:Ranbp9 UTSW 13 43419626 missense probably benign 0.01
R7069:Ranbp9 UTSW 13 43419622 missense probably benign 0.24
R7115:Ranbp9 UTSW 13 43406671 missense probably benign 0.04
R7382:Ranbp9 UTSW 13 43425114 missense probably damaging 0.99
R7826:Ranbp9 UTSW 13 43419621 missense possibly damaging 0.46
X0024:Ranbp9 UTSW 13 43425085 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GGATTCCCTCAAAGCGTCCA -3'
(R):5'- GTCGGTCTCCTCAACCGC -3'

Sequencing Primer
(F):5'- AGCTCCGGGCCTAGGGATC -3'
(R):5'- CCCGGTGGAGGCTTGGG -3'
Posted On2019-06-26