Incidental Mutation 'R7298:Zfp346'
ID566813
Institutional Source Beutler Lab
Gene Symbol Zfp346
Ensembl Gene ENSMUSG00000021481
Gene Namezinc finger protein 346
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R7298 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location55105311-55134825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 55130603 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 258 (V258G)
Ref Sequence ENSEMBL: ENSMUSP00000021937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021937] [ENSMUST00000159147] [ENSMUST00000159278] [ENSMUST00000160660] [ENSMUST00000161315] [ENSMUST00000161551] [ENSMUST00000162428] [ENSMUST00000162476] [ENSMUST00000164344]
Predicted Effect probably damaging
Transcript: ENSMUST00000021937
AA Change: V258G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021937
Gene: ENSMUSG00000021481
AA Change: V258G

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
ZnF_U1 131 165 5.22e-7 SMART
ZnF_C2H2 134 158 4.98e-1 SMART
ZnF_U1 182 216 1.87e-8 SMART
ZnF_C2H2 185 209 1.51e1 SMART
ZnF_U1 236 270 1.99e-3 SMART
ZnF_C2H2 239 263 3.47e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159147
AA Change: V226G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124107
Gene: ENSMUSG00000021481
AA Change: V226G

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:zf-met 73 96 3.3e-5 PFAM
ZnF_U1 99 133 5.22e-7 SMART
ZnF_C2H2 102 126 4.98e-1 SMART
ZnF_U1 150 184 1.87e-8 SMART
ZnF_C2H2 153 177 1.51e1 SMART
ZnF_U1 204 238 1.99e-3 SMART
ZnF_C2H2 207 231 3.47e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159278
AA Change: V273G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125078
Gene: ENSMUSG00000021481
AA Change: V273G

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
ZnF_U1 131 165 5.22e-7 SMART
ZnF_C2H2 134 158 4.98e-1 SMART
ZnF_U1 198 232 1.87e-8 SMART
ZnF_C2H2 201 225 1.51e1 SMART
ZnF_U1 251 285 1.99e-3 SMART
ZnF_C2H2 254 278 3.47e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160660
SMART Domains Protein: ENSMUSP00000124034
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161077
SMART Domains Protein: ENSMUSP00000125204
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
ZnF_U1 52 86 1.26e-5 SMART
ZnF_C2H2 55 79 2.61e1 SMART
ZnF_U1 113 147 5.22e-7 SMART
ZnF_C2H2 116 140 4.98e-1 SMART
ZnF_U1 180 214 1.87e-8 SMART
ZnF_C2H2 183 207 1.51e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161315
SMART Domains Protein: ENSMUSP00000124397
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161551
SMART Domains Protein: ENSMUSP00000124180
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
PDB:1ZU1|A 53 93 4e-12 PDB
Blast:ZnF_U1 70 94 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162428
SMART Domains Protein: ENSMUSP00000125389
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162476
SMART Domains Protein: ENSMUSP00000125743
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164344
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleolar, zinc finger protein that preferentially binds to double-stranded (ds) RNA or RNA/DNA hybrids, rather than DNA alone. Mutational studies indicate that the zinc finger domains are not only essential for dsRNA binding, but are also required for its nucleolar localization. The encoded protein may be involved in cell growth and survival. It plays a role in protecting neurons by inhibiting cell cycle re-entry via stimulation of p21 gene expression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,883 T51S probably benign Het
Abcc1 A G 16: 14,396,472 D204G possibly damaging Het
Acaa1b C T 9: 119,151,847 E172K probably benign Het
Adamts5 G A 16: 85,899,918 T117I probably benign Het
Agmat A G 4: 141,746,964 E52G possibly damaging Het
Alg9 C T 9: 50,779,061 A121V probably damaging Het
Atf7ip2 T C 16: 10,209,168 I100T possibly damaging Het
Calm2 T C 17: 87,442,737 probably null Het
Cfap44 A T 16: 44,481,412 M1838L probably benign Het
Cym A G 3: 107,219,693 Y49H probably benign Het
Dchs1 G A 7: 105,755,131 R2735* probably null Het
Dnajc6 T C 4: 101,606,611 I187T probably benign Het
Fam151a G T 4: 106,735,528 R69L possibly damaging Het
Gm13089 C A 4: 143,698,505 D123Y probably benign Het
Gm14548 T A 7: 3,895,265 I353F possibly damaging Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm9922 C A 14: 101,729,525 G97V unknown Het
Hacl1 A T 14: 31,616,486 M378K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-82 A T 12: 115,952,954 I6N possibly damaging Het
Kctd19 A C 8: 105,382,984 V942G probably benign Het
Lce1l C T 3: 92,850,176 C125Y unknown Het
Mmp8 T C 9: 7,560,448 F42S probably damaging Het
Myom2 T C 8: 15,098,411 L529P probably damaging Het
Nectin3 A T 16: 46,448,396 Y548N probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1255 T C 2: 89,816,521 F59S probably damaging Het
Olfr303 T A 7: 86,394,923 T192S probably damaging Het
Otof T A 5: 30,388,270 I514F probably damaging Het
Plch1 G T 3: 63,716,037 S603* probably null Het
Ppa1 T A 10: 61,666,912 D171E probably benign Het
Prss34 T C 17: 25,299,763 C240R probably damaging Het
Ptpre A G 7: 135,683,287 D714G probably damaging Het
Ranbp9 A G 13: 43,480,460 F157L probably benign Het
Rbbp6 A G 7: 123,001,194 K1475E unknown Het
Retnlg A G 16: 48,872,874 N5D probably benign Het
Rev1 T C 1: 38,053,104 T1245A probably damaging Het
Rngtt G T 4: 33,362,927 L360F probably damaging Het
Scrib A C 15: 76,064,761 V447G probably damaging Het
Slc22a6 C A 19: 8,621,320 A247E possibly damaging Het
Slc25a20 G A 9: 108,662,144 probably benign Het
Spag16 T A 1: 69,919,426 probably null Het
Stx3 C T 19: 11,790,048 W87* probably null Het
Syngap1 T A 17: 26,962,987 M1158K possibly damaging Het
Tmed9 C A 13: 55,593,294 H41N possibly damaging Het
Trav15-2-dv6-2 G A 14: 53,649,785 S54N probably benign Het
Tyk2 C T 9: 21,108,860 V1001I probably benign Het
Ugt8a A G 3: 125,915,416 V15A probably benign Het
Uhrf2 A G 19: 30,088,549 E661G probably benign Het
Vmn2r77 T A 7: 86,800,771 I75N probably benign Het
Zfp72 T A 13: 74,372,394 K188N possibly damaging Het
Zgrf1 C A 3: 127,583,650 S848* probably null Het
Other mutations in Zfp346
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0480:Zfp346 UTSW 13 55113097 nonsense probably null
R2025:Zfp346 UTSW 13 55132308 missense probably damaging 1.00
R2879:Zfp346 UTSW 13 55105350 missense possibly damaging 0.66
R4564:Zfp346 UTSW 13 55113707 missense probably damaging 1.00
R4821:Zfp346 UTSW 13 55113813 intron probably benign
R5647:Zfp346 UTSW 13 55122357 missense probably damaging 1.00
R5665:Zfp346 UTSW 13 55113102 missense probably benign 0.39
R6145:Zfp346 UTSW 13 55115574 missense probably damaging 0.98
R6450:Zfp346 UTSW 13 55113704 missense probably damaging 1.00
R7034:Zfp346 UTSW 13 55132387 missense probably benign 0.28
R7036:Zfp346 UTSW 13 55132387 missense probably benign 0.28
R7148:Zfp346 UTSW 13 55105450 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ATAGTGTTACACGGCCTTGC -3'
(R):5'- AATGCTAGCTGAAGGGCTGATG -3'

Sequencing Primer
(F):5'- AGGCCTCTCAGTTAGTTCCAAG -3'
(R):5'- GCTGATGGAGGAGACCCAC -3'
Posted On2019-06-26