Incidental Mutation 'R7298:Hacl1'
ID566816
Institutional Source Beutler Lab
Gene Symbol Hacl1
Ensembl Gene ENSMUSG00000021884
Gene Name2-hydroxyacyl-CoA lyase 1
SynonymsHpcl, Phyh2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7298 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31598730-31641286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31616486 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 378 (M378K)
Ref Sequence ENSEMBL: ENSMUSP00000022437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022437] [ENSMUST00000127204] [ENSMUST00000156431] [ENSMUST00000165955] [ENSMUST00000167066] [ENSMUST00000167175] [ENSMUST00000171414]
Predicted Effect probably damaging
Transcript: ENSMUST00000022437
AA Change: M378K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022437
Gene: ENSMUSG00000021884
AA Change: M378K

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 185 6.1e-46 PFAM
Pfam:TPP_enzyme_M 206 335 1.9e-34 PFAM
Pfam:TPP_enzyme_C 400 560 1.6e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127204
AA Change: M351K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120452
Gene: ENSMUSG00000021884
AA Change: M351K

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 81 1.3e-14 PFAM
Pfam:TPP_enzyme_N 75 159 3.3e-14 PFAM
Pfam:TPP_enzyme_M 179 310 1.5e-34 PFAM
Pfam:TPP_enzyme_C 373 533 7.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140078
Predicted Effect probably damaging
Transcript: ENSMUST00000156431
AA Change: M378K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114922
Gene: ENSMUSG00000021884
AA Change: M378K

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 186 3.3e-46 PFAM
Pfam:TPP_enzyme_M 206 337 2.1e-34 PFAM
Pfam:TPP_enzyme_C 400 560 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165955
SMART Domains Protein: ENSMUSP00000129090
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 105 3.7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167066
AA Change: M318K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132913
Gene: ENSMUSG00000021884
AA Change: M318K

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 131 2.5e-33 PFAM
Pfam:TPP_enzyme_M 180 311 4.7e-34 PFAM
Pfam:TPP_enzyme_C 340 500 6.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167175
SMART Domains Protein: ENSMUSP00000128588
Gene: ENSMUSG00000115022

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 139 3.6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171414
SMART Domains Protein: ENSMUSP00000130268
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 109 1.3e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,883 T51S probably benign Het
Abcc1 A G 16: 14,396,472 D204G possibly damaging Het
Acaa1b C T 9: 119,151,847 E172K probably benign Het
Adamts5 G A 16: 85,899,918 T117I probably benign Het
Agmat A G 4: 141,746,964 E52G possibly damaging Het
Alg9 C T 9: 50,779,061 A121V probably damaging Het
Atf7ip2 T C 16: 10,209,168 I100T possibly damaging Het
Calm2 T C 17: 87,442,737 probably null Het
Cfap44 A T 16: 44,481,412 M1838L probably benign Het
Cym A G 3: 107,219,693 Y49H probably benign Het
Dchs1 G A 7: 105,755,131 R2735* probably null Het
Dnajc6 T C 4: 101,606,611 I187T probably benign Het
Fam151a G T 4: 106,735,528 R69L possibly damaging Het
Gm13089 C A 4: 143,698,505 D123Y probably benign Het
Gm14548 T A 7: 3,895,265 I353F possibly damaging Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm9922 C A 14: 101,729,525 G97V unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-82 A T 12: 115,952,954 I6N possibly damaging Het
Kctd19 A C 8: 105,382,984 V942G probably benign Het
Lce1l C T 3: 92,850,176 C125Y unknown Het
Mmp8 T C 9: 7,560,448 F42S probably damaging Het
Myom2 T C 8: 15,098,411 L529P probably damaging Het
Nectin3 A T 16: 46,448,396 Y548N probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1255 T C 2: 89,816,521 F59S probably damaging Het
Olfr303 T A 7: 86,394,923 T192S probably damaging Het
Otof T A 5: 30,388,270 I514F probably damaging Het
Plch1 G T 3: 63,716,037 S603* probably null Het
Ppa1 T A 10: 61,666,912 D171E probably benign Het
Prss34 T C 17: 25,299,763 C240R probably damaging Het
Ptpre A G 7: 135,683,287 D714G probably damaging Het
Ranbp9 A G 13: 43,480,460 F157L probably benign Het
Rbbp6 A G 7: 123,001,194 K1475E unknown Het
Retnlg A G 16: 48,872,874 N5D probably benign Het
Rev1 T C 1: 38,053,104 T1245A probably damaging Het
Rngtt G T 4: 33,362,927 L360F probably damaging Het
Scrib A C 15: 76,064,761 V447G probably damaging Het
Slc22a6 C A 19: 8,621,320 A247E possibly damaging Het
Slc25a20 G A 9: 108,662,144 probably benign Het
Spag16 T A 1: 69,919,426 probably null Het
Stx3 C T 19: 11,790,048 W87* probably null Het
Syngap1 T A 17: 26,962,987 M1158K possibly damaging Het
Tmed9 C A 13: 55,593,294 H41N possibly damaging Het
Trav15-2-dv6-2 G A 14: 53,649,785 S54N probably benign Het
Tyk2 C T 9: 21,108,860 V1001I probably benign Het
Ugt8a A G 3: 125,915,416 V15A probably benign Het
Uhrf2 A G 19: 30,088,549 E661G probably benign Het
Vmn2r77 T A 7: 86,800,771 I75N probably benign Het
Zfp346 T G 13: 55,130,603 V258G probably damaging Het
Zfp72 T A 13: 74,372,394 K188N possibly damaging Het
Zgrf1 C A 3: 127,583,650 S848* probably null Het
Other mutations in Hacl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Hacl1 APN 14 31626417 missense probably benign 0.04
IGL01548:Hacl1 APN 14 31640596 missense possibly damaging 0.78
IGL01952:Hacl1 APN 14 31641122 unclassified probably benign
IGL02059:Hacl1 APN 14 31632934 missense probably benign 0.00
IGL02138:Hacl1 APN 14 31630983 missense probably benign 0.05
IGL02637:Hacl1 APN 14 31640501 missense probably damaging 1.00
IGL03235:Hacl1 APN 14 31631038 nonsense probably null
R0502:Hacl1 UTSW 14 31622984 splice site probably benign
R1697:Hacl1 UTSW 14 31621000 splice site probably null
R1800:Hacl1 UTSW 14 31614264 missense probably damaging 1.00
R1829:Hacl1 UTSW 14 31640534 missense probably benign 0.00
R3937:Hacl1 UTSW 14 31634191 splice site probably benign
R3938:Hacl1 UTSW 14 31634191 splice site probably benign
R5004:Hacl1 UTSW 14 31619039 missense probably benign
R5776:Hacl1 UTSW 14 31622871 missense possibly damaging 0.90
R5868:Hacl1 UTSW 14 31619916 missense probably damaging 1.00
R5929:Hacl1 UTSW 14 31616388 missense probably benign 0.04
R6261:Hacl1 UTSW 14 31635771 missense probably damaging 1.00
R6996:Hacl1 UTSW 14 31615423 missense possibly damaging 0.96
R7768:Hacl1 UTSW 14 31616480 missense probably damaging 1.00
R7887:Hacl1 UTSW 14 31634227 missense probably damaging 1.00
R7970:Hacl1 UTSW 14 31634227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAATGAGACCCGCTGTC -3'
(R):5'- TATTCATTGTGTCCCAGCTGG -3'

Sequencing Primer
(F):5'- AAATGAGACCCGCTGTCATTTC -3'
(R):5'- TTCACAGTTGAAAGAGTAGCTGC -3'
Posted On2019-06-26