Incidental Mutation 'R7298:Scrib'
ID566819
Institutional Source Beutler Lab
Gene Symbol Scrib
Ensembl Gene ENSMUSG00000022568
Gene Namescribbled planar cell polarity
SynonymsScrb1, Crc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7298 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76047158-76069784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 76064761 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 447 (V447G)
Ref Sequence ENSEMBL: ENSMUSP00000002603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002603] [ENSMUST00000063747] [ENSMUST00000109946]
Predicted Effect probably damaging
Transcript: ENSMUST00000002603
AA Change: V447G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002603
Gene: ENSMUSG00000022568
AA Change: V447G

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1306 1321 N/A INTRINSIC
coiled coil region 1390 1420 N/A INTRINSIC
low complexity region 1452 1464 N/A INTRINSIC
low complexity region 1498 1515 N/A INTRINSIC
low complexity region 1549 1560 N/A INTRINSIC
low complexity region 1648 1665 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063747
AA Change: V447G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000068056
Gene: ENSMUSG00000022568
AA Change: V447G

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1595 1612 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109946
AA Change: V447G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105572
Gene: ENSMUSG00000022568
AA Change: V447G

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1620 1637 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified as being similar to the Drosophila scribble protein. The mammalian protein is involved in tumor suppression pathways. As a scaffold protein involved in cell polarization processes, this protein binds to many other proteins. The encoded protein binds to papillomavirus E6 protein via its PDZ domain and the C-terminus of E6. Two alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele display partial prenatal lethality. Mice homozygous for spontaneous or induced alleles exhibit craniofacial or neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,883 T51S probably benign Het
Abcc1 A G 16: 14,396,472 D204G possibly damaging Het
Acaa1b C T 9: 119,151,847 E172K probably benign Het
Adamts5 G A 16: 85,899,918 T117I probably benign Het
Agmat A G 4: 141,746,964 E52G possibly damaging Het
Alg9 C T 9: 50,779,061 A121V probably damaging Het
Atf7ip2 T C 16: 10,209,168 I100T possibly damaging Het
Calm2 T C 17: 87,442,737 probably null Het
Cfap44 A T 16: 44,481,412 M1838L probably benign Het
Cym A G 3: 107,219,693 Y49H probably benign Het
Dchs1 G A 7: 105,755,131 R2735* probably null Het
Dnajc6 T C 4: 101,606,611 I187T probably benign Het
Fam151a G T 4: 106,735,528 R69L possibly damaging Het
Gm13089 C A 4: 143,698,505 D123Y probably benign Het
Gm14548 T A 7: 3,895,265 I353F possibly damaging Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm9922 C A 14: 101,729,525 G97V unknown Het
Hacl1 A T 14: 31,616,486 M378K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-82 A T 12: 115,952,954 I6N possibly damaging Het
Kctd19 A C 8: 105,382,984 V942G probably benign Het
Lce1l C T 3: 92,850,176 C125Y unknown Het
Mmp8 T C 9: 7,560,448 F42S probably damaging Het
Myom2 T C 8: 15,098,411 L529P probably damaging Het
Nectin3 A T 16: 46,448,396 Y548N probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1255 T C 2: 89,816,521 F59S probably damaging Het
Olfr303 T A 7: 86,394,923 T192S probably damaging Het
Otof T A 5: 30,388,270 I514F probably damaging Het
Plch1 G T 3: 63,716,037 S603* probably null Het
Ppa1 T A 10: 61,666,912 D171E probably benign Het
Prss34 T C 17: 25,299,763 C240R probably damaging Het
Ptpre A G 7: 135,683,287 D714G probably damaging Het
Ranbp9 A G 13: 43,480,460 F157L probably benign Het
Rbbp6 A G 7: 123,001,194 K1475E unknown Het
Retnlg A G 16: 48,872,874 N5D probably benign Het
Rev1 T C 1: 38,053,104 T1245A probably damaging Het
Rngtt G T 4: 33,362,927 L360F probably damaging Het
Slc22a6 C A 19: 8,621,320 A247E possibly damaging Het
Slc25a20 G A 9: 108,662,144 probably benign Het
Spag16 T A 1: 69,919,426 probably null Het
Stx3 C T 19: 11,790,048 W87* probably null Het
Syngap1 T A 17: 26,962,987 M1158K possibly damaging Het
Tmed9 C A 13: 55,593,294 H41N possibly damaging Het
Trav15-2-dv6-2 G A 14: 53,649,785 S54N probably benign Het
Tyk2 C T 9: 21,108,860 V1001I probably benign Het
Ugt8a A G 3: 125,915,416 V15A probably benign Het
Uhrf2 A G 19: 30,088,549 E661G probably benign Het
Vmn2r77 T A 7: 86,800,771 I75N probably benign Het
Zfp346 T G 13: 55,130,603 V258G probably damaging Het
Zfp72 T A 13: 74,372,394 K188N possibly damaging Het
Zgrf1 C A 3: 127,583,650 S848* probably null Het
Other mutations in Scrib
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Scrib APN 15 76048794 missense possibly damaging 0.49
IGL00905:Scrib APN 15 76064990 missense probably damaging 0.96
IGL01529:Scrib APN 15 76049235 missense possibly damaging 0.66
IGL01896:Scrib APN 15 76066118 missense possibly damaging 0.75
IGL01947:Scrib APN 15 76061767 missense probably benign 0.01
IGL02219:Scrib APN 15 76065036 nonsense probably null
IGL02372:Scrib APN 15 76048255 missense probably damaging 0.99
IGL02880:Scrib APN 15 76066124 missense probably damaging 1.00
IGL02959:Scrib APN 15 76065207 missense probably damaging 0.99
R0605:Scrib UTSW 15 76067553 missense possibly damaging 0.89
R0711:Scrib UTSW 15 76066907 unclassified probably benign
R0757:Scrib UTSW 15 76062750 small deletion probably benign
R0903:Scrib UTSW 15 76066855 missense possibly damaging 0.95
R0959:Scrib UTSW 15 76051461 missense probably benign 0.34
R1483:Scrib UTSW 15 76057922 missense probably damaging 1.00
R1551:Scrib UTSW 15 76065162 missense probably damaging 1.00
R1604:Scrib UTSW 15 76048240 missense probably damaging 0.97
R1613:Scrib UTSW 15 76048542 missense probably damaging 1.00
R1615:Scrib UTSW 15 76066205 missense probably benign 0.39
R1681:Scrib UTSW 15 76064567 missense probably damaging 1.00
R3110:Scrib UTSW 15 76069374 missense probably damaging 0.98
R3112:Scrib UTSW 15 76069374 missense probably damaging 0.98
R4050:Scrib UTSW 15 76051473 missense possibly damaging 0.91
R4660:Scrib UTSW 15 76065336 missense probably damaging 0.98
R4976:Scrib UTSW 15 76051753 critical splice donor site probably null
R5119:Scrib UTSW 15 76051753 critical splice donor site probably null
R5243:Scrib UTSW 15 76065252 missense probably benign 0.00
R5246:Scrib UTSW 15 76064797 missense probably benign 0.19
R5483:Scrib UTSW 15 76067659 critical splice donor site probably null
R5516:Scrib UTSW 15 76062863 missense possibly damaging 0.50
R5628:Scrib UTSW 15 76049540 missense possibly damaging 0.66
R5787:Scrib UTSW 15 76059302 missense probably damaging 1.00
R5894:Scrib UTSW 15 76067732 missense probably damaging 0.99
R6005:Scrib UTSW 15 76057751 missense probably damaging 1.00
R6041:Scrib UTSW 15 76067172 missense possibly damaging 0.93
R6351:Scrib UTSW 15 76064986 missense possibly damaging 0.65
R6603:Scrib UTSW 15 76062723 missense probably benign 0.00
R7344:Scrib UTSW 15 76049258 missense probably damaging 1.00
R7428:Scrib UTSW 15 76061198 missense probably damaging 1.00
R7486:Scrib UTSW 15 76057650 missense probably damaging 1.00
R7764:Scrib UTSW 15 76047393 makesense probably null
R8084:Scrib UTSW 15 76066091 missense probably benign 0.07
R8096:Scrib UTSW 15 76062709 missense probably benign
R8157:Scrib UTSW 15 76059188 missense possibly damaging 0.52
R8217:Scrib UTSW 15 76067155 missense probably damaging 0.99
Z1088:Scrib UTSW 15 76048231 missense probably damaging 0.99
Z1177:Scrib UTSW 15 76057770 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCACCTTGAGCTCACTG -3'
(R):5'- ACTGAGGATGATGCCCAGAC -3'

Sequencing Primer
(F):5'- ATCACCTTGAGCTCACTGGGATG -3'
(R):5'- CGGGTGAAAAGGTGCTCAC -3'
Posted On2019-06-26