Incidental Mutation 'R0636:Adprhl1'
ID56682
Institutional Source Beutler Lab
Gene Symbol Adprhl1
Ensembl Gene ENSMUSG00000031448
Gene NameADP-ribosylhydrolase like 1
SynonymsArh2, D330008N11Rik
MMRRC Submission 038825-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0636 (G1)
Quality Score171
Status Validated
Chromosome8
Chromosomal Location13221663-13254162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13248702 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 76 (D76G)
Ref Sequence ENSEMBL: ENSMUSP00000145145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033825] [ENSMUST00000168498] [ENSMUST00000171619] [ENSMUST00000204916]
Predicted Effect probably damaging
Transcript: ENSMUST00000033825
AA Change: D76G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033825
Gene: ENSMUSG00000031448
AA Change: D76G

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 6 327 1.2e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168498
SMART Domains Protein: ENSMUSP00000131920
Gene: ENSMUSG00000031448

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 69 196 9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171619
SMART Domains Protein: ENSMUSP00000132014
Gene: ENSMUSG00000031448

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 1 135 4.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204916
AA Change: D76G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145145
Gene: ENSMUSG00000031448
AA Change: D76G

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 6 327 4.2e-49 PFAM
low complexity region 509 527 N/A INTRINSIC
low complexity region 955 969 N/A INTRINSIC
internal_repeat_1 1047 1150 1.82e-5 PROSPERO
internal_repeat_1 1157 1274 1.82e-5 PROSPERO
low complexity region 1275 1290 N/A INTRINSIC
Meta Mutation Damage Score 0.1429 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation is a reversible posttranslational modification used to regulate protein function. ADP-ribosyltransferases (see ART1; MIM 601625) transfer ADP-ribose from NAD+ to the target protein, and ADP-ribosylhydrolases, such as ADPRHL1, reverse the reaction (Glowacki et al., 2002 [PubMed 12070318]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,231,217 Y264C probably damaging Het
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Aco1 A G 4: 40,175,697 E146G probably damaging Het
Adam2 T G 14: 66,034,816 D639A probably benign Het
Adh4 G T 3: 138,428,074 R315L probably damaging Het
AF366264 T C 8: 13,837,870 R74G probably benign Het
Akip1 T C 7: 109,707,519 probably benign Het
Ap3d1 T A 10: 80,719,382 K370* probably null Het
Arfgef1 C A 1: 10,199,851 V358L probably benign Het
Arpp21 A T 9: 112,183,498 D85E probably benign Het
Azi2 A T 9: 118,062,057 L383F probably benign Het
Bpgm T A 6: 34,504,287 D206E probably benign Het
Bsn T C 9: 108,107,834 D3007G unknown Het
Ccdc142 T G 6: 83,107,198 probably benign Het
Cep135 T C 5: 76,615,657 V498A probably benign Het
Cntn6 A T 6: 104,863,148 Q1003L probably benign Het
Cntnap2 T A 6: 47,296,708 probably benign Het
Csf2rb2 G A 15: 78,291,960 Q139* probably null Het
Cyp3a16 A G 5: 145,463,085 V101A probably benign Het
D630045J12Rik T C 6: 38,196,778 T152A probably benign Het
Def8 G A 8: 123,454,357 W176* probably null Het
Dgkg A G 16: 22,579,729 probably benign Het
Ear10 T C 14: 43,922,994 probably null Het
Fbxw2 A T 2: 34,822,847 Y67* probably null Het
Flii T A 11: 60,715,552 Y1104F probably damaging Het
Gm973 G A 1: 59,551,144 R270K probably benign Het
Gm9833 T C 3: 10,088,783 L204P possibly damaging Het
Gnl3 T A 14: 31,017,153 K75N probably damaging Het
Gpc6 A T 14: 117,624,493 M274L probably benign Het
Ifi47 A G 11: 49,096,651 E415G possibly damaging Het
Ift57 A G 16: 49,711,896 T130A probably benign Het
Itpr2 T A 6: 146,171,412 D2373V probably damaging Het
Kat6a T C 8: 22,939,323 S1565P possibly damaging Het
Klhl6 A T 16: 19,948,073 probably benign Het
Klra2 T C 6: 131,220,104 probably benign Het
Lama5 A G 2: 180,189,331 probably null Het
Mapk4 A G 18: 73,930,454 S566P probably benign Het
Mindy4 C A 6: 55,276,585 R480S possibly damaging Het
Mterf3 T C 13: 66,922,753 probably benign Het
Mtmr2 A G 9: 13,801,913 probably null Het
Naip5 T C 13: 100,219,688 T1140A probably benign Het
Nf1 A G 11: 79,535,703 T1648A probably damaging Het
Nlk A T 11: 78,695,844 D141E probably benign Het
Noxa1 C A 2: 25,086,094 probably benign Het
Olfr1279 A G 2: 111,306,412 N69S probably benign Het
Olfr1480 A T 19: 13,530,249 Y236F possibly damaging Het
Olfr476 T C 7: 107,967,472 V25A probably benign Het
Otog G A 7: 46,264,228 probably null Het
Pebp4 T C 14: 70,048,347 probably benign Het
Phgdh G T 3: 98,333,291 N100K possibly damaging Het
Pnisr T A 4: 21,873,800 probably benign Het
Ptpn6 T C 6: 124,725,279 H346R probably benign Het
Rsf1 T C 7: 97,662,019 V652A possibly damaging Het
Rubcn G A 16: 32,828,686 H624Y probably damaging Het
Setdb2 T C 14: 59,406,704 N656D probably benign Het
Slc22a23 T C 13: 34,299,093 T268A probably benign Het
Slc3a1 A T 17: 85,032,794 T215S possibly damaging Het
Srsf2 A G 11: 116,852,078 S206P probably benign Het
Susd2 T A 10: 75,639,350 D542V probably damaging Het
Svep1 G A 4: 58,073,121 Q2063* probably null Het
Syne2 G A 12: 75,930,983 V1401M possibly damaging Het
Tenm2 A G 11: 36,943,976 L64P probably damaging Het
Tigd2 A G 6: 59,211,287 T380A possibly damaging Het
Trmt12 G T 15: 58,873,985 V411F probably damaging Het
Ubr4 T C 4: 139,436,302 probably null Het
Ush2a G A 1: 188,822,738 C3571Y probably benign Het
Usp8 A G 2: 126,720,110 M75V possibly damaging Het
Vcan C T 13: 89,704,706 D712N probably damaging Het
Vcan C A 13: 89,712,267 R327L probably damaging Het
Vps8 A G 16: 21,434,933 E8G probably benign Het
Washc5 T C 15: 59,359,409 D335G probably benign Het
Zbtb39 A G 10: 127,742,835 N426S probably benign Het
Zfp184 T A 13: 21,949,749 D55E probably damaging Het
Zfp882 T C 8: 71,914,337 V336A probably benign Het
Other mutations in Adprhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03268:Adprhl1 APN 8 13246170 splice site probably benign
R0244:Adprhl1 UTSW 8 13242391 splice site probably benign
R1295:Adprhl1 UTSW 8 13248624 missense probably damaging 1.00
R2111:Adprhl1 UTSW 8 13248694 missense probably damaging 1.00
R2112:Adprhl1 UTSW 8 13248694 missense probably damaging 1.00
R2184:Adprhl1 UTSW 8 13242559 missense probably benign 0.00
R4411:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4412:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4413:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4615:Adprhl1 UTSW 8 13242250 critical splice donor site probably null
R4618:Adprhl1 UTSW 8 13242250 critical splice donor site probably null
R5016:Adprhl1 UTSW 8 13224889 missense possibly damaging 0.88
R5058:Adprhl1 UTSW 8 13242625 missense probably damaging 1.00
R5060:Adprhl1 UTSW 8 13248621 missense possibly damaging 0.63
R5209:Adprhl1 UTSW 8 13242563 nonsense probably null
R6103:Adprhl1 UTSW 8 13222055 missense possibly damaging 0.91
R6158:Adprhl1 UTSW 8 13224977 missense possibly damaging 0.93
R6221:Adprhl1 UTSW 8 13225634 missense probably benign 0.01
R6971:Adprhl1 UTSW 8 13223476 missense probably benign
R7087:Adprhl1 UTSW 8 13221856 missense probably damaging 0.99
R7362:Adprhl1 UTSW 8 13245534 missense probably damaging 1.00
R7404:Adprhl1 UTSW 8 13225118 missense probably damaging 0.99
R7422:Adprhl1 UTSW 8 13222873 missense probably benign 0.28
R7439:Adprhl1 UTSW 8 13223069 missense probably benign 0.01
R7441:Adprhl1 UTSW 8 13223069 missense probably benign 0.01
R7772:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7773:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7774:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7776:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7876:Adprhl1 UTSW 8 13223509 missense probably benign 0.00
R7877:Adprhl1 UTSW 8 13225316 nonsense probably null
R7959:Adprhl1 UTSW 8 13223509 missense probably benign 0.00
R7960:Adprhl1 UTSW 8 13225316 nonsense probably null
R8155:Adprhl1 UTSW 8 13221764 missense probably damaging 0.99
Z1176:Adprhl1 UTSW 8 13225613 missense probably benign 0.01
Z1177:Adprhl1 UTSW 8 13245476 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGCTCAAGCAAGCTGGGATAGCTC -3'
(R):5'- TGAAGGTGGTGGATGTTCCCTAGAC -3'

Sequencing Primer
(F):5'- CTGTCAAAGGATCTGATCCAGATG -3'
(R):5'- GGATGTTCCCTAGACCCTCG -3'
Posted On2013-07-11