Incidental Mutation 'R7298:Cfap44'
ID566822
Institutional Source Beutler Lab
Gene Symbol Cfap44
Ensembl Gene ENSMUSG00000071550
Gene Namecilia and flagella associated protein 44
Synonyms6330444M21Rik, D16Ertd642e, Wdr52
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7298 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location44394796-44482428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44481412 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1838 (M1838L)
Ref Sequence ENSEMBL: ENSMUSP00000097331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000114634] [ENSMUST00000120049]
Predicted Effect probably benign
Transcript: ENSMUST00000099742
AA Change: M1838L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: M1838L

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114634
SMART Domains Protein: ENSMUSP00000110281
Gene: ENSMUSG00000022687

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IGc2 43 108 4.36e-4 SMART
IG 130 217 8.99e-6 SMART
IGc2 238 301 3.94e-11 SMART
IGc2 330 393 1.46e-14 SMART
low complexity region 423 433 N/A INTRINSIC
FN3 467 553 1.14e-5 SMART
FN3 601 685 3.53e-11 SMART
FN3 707 794 4.25e-5 SMART
low complexity region 813 829 N/A INTRINSIC
transmembrane domain 851 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120049
AA Change: M1838L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: M1838L

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (52/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,883 T51S probably benign Het
Abcc1 A G 16: 14,396,472 D204G possibly damaging Het
Acaa1b C T 9: 119,151,847 E172K probably benign Het
Adamts5 G A 16: 85,899,918 T117I probably benign Het
Agmat A G 4: 141,746,964 E52G possibly damaging Het
Alg9 C T 9: 50,779,061 A121V probably damaging Het
Atf7ip2 T C 16: 10,209,168 I100T possibly damaging Het
Calm2 T C 17: 87,442,737 probably null Het
Cym A G 3: 107,219,693 Y49H probably benign Het
Dchs1 G A 7: 105,755,131 R2735* probably null Het
Dnajc6 T C 4: 101,606,611 I187T probably benign Het
Fam151a G T 4: 106,735,528 R69L possibly damaging Het
Gm13089 C A 4: 143,698,505 D123Y probably benign Het
Gm14548 T A 7: 3,895,265 I353F possibly damaging Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm9922 C A 14: 101,729,525 G97V unknown Het
Hacl1 A T 14: 31,616,486 M378K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-82 A T 12: 115,952,954 I6N possibly damaging Het
Kctd19 A C 8: 105,382,984 V942G probably benign Het
Lce1l C T 3: 92,850,176 C125Y unknown Het
Mmp8 T C 9: 7,560,448 F42S probably damaging Het
Myom2 T C 8: 15,098,411 L529P probably damaging Het
Nectin3 A T 16: 46,448,396 Y548N probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1255 T C 2: 89,816,521 F59S probably damaging Het
Olfr303 T A 7: 86,394,923 T192S probably damaging Het
Otof T A 5: 30,388,270 I514F probably damaging Het
Plch1 G T 3: 63,716,037 S603* probably null Het
Ppa1 T A 10: 61,666,912 D171E probably benign Het
Prss34 T C 17: 25,299,763 C240R probably damaging Het
Ptpre A G 7: 135,683,287 D714G probably damaging Het
Ranbp9 A G 13: 43,480,460 F157L probably benign Het
Rbbp6 A G 7: 123,001,194 K1475E unknown Het
Retnlg A G 16: 48,872,874 N5D probably benign Het
Rev1 T C 1: 38,053,104 T1245A probably damaging Het
Rngtt G T 4: 33,362,927 L360F probably damaging Het
Scrib A C 15: 76,064,761 V447G probably damaging Het
Slc22a6 C A 19: 8,621,320 A247E possibly damaging Het
Slc25a20 G A 9: 108,662,144 probably benign Het
Spag16 T A 1: 69,919,426 probably null Het
Stx3 C T 19: 11,790,048 W87* probably null Het
Syngap1 T A 17: 26,962,987 M1158K possibly damaging Het
Tmed9 C A 13: 55,593,294 H41N possibly damaging Het
Trav15-2-dv6-2 G A 14: 53,649,785 S54N probably benign Het
Tyk2 C T 9: 21,108,860 V1001I probably benign Het
Ugt8a A G 3: 125,915,416 V15A probably benign Het
Uhrf2 A G 19: 30,088,549 E661G probably benign Het
Vmn2r77 T A 7: 86,800,771 I75N probably benign Het
Zfp346 T G 13: 55,130,603 V258G probably damaging Het
Zfp72 T A 13: 74,372,394 K188N possibly damaging Het
Zgrf1 C A 3: 127,583,650 S848* probably null Het
Other mutations in Cfap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Cfap44 APN 16 44407404 missense probably damaging 0.99
IGL00952:Cfap44 APN 16 44421275 missense probably benign 0.33
IGL01340:Cfap44 APN 16 44404130 missense probably damaging 1.00
IGL01530:Cfap44 APN 16 44449167 missense probably damaging 1.00
IGL02083:Cfap44 APN 16 44437162 missense probably damaging 1.00
IGL02088:Cfap44 APN 16 44451628 missense possibly damaging 0.59
IGL02142:Cfap44 APN 16 44421144 missense probably benign 0.15
IGL02311:Cfap44 APN 16 44404771 splice site probably benign
IGL02574:Cfap44 APN 16 44481383 missense probably damaging 1.00
IGL02893:Cfap44 APN 16 44416817 missense probably damaging 1.00
IGL02959:Cfap44 APN 16 44470867 splice site probably benign
IGL03291:Cfap44 APN 16 44407311 missense possibly damaging 0.86
feldgrau UTSW 16 44433666 nonsense probably null
I2288:Cfap44 UTSW 16 44449138 nonsense probably null
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0036:Cfap44 UTSW 16 44439069 missense possibly damaging 0.83
R0139:Cfap44 UTSW 16 44433422 missense possibly damaging 0.90
R0145:Cfap44 UTSW 16 44468372 missense probably damaging 1.00
R0193:Cfap44 UTSW 16 44449210 splice site probably null
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0288:Cfap44 UTSW 16 44415894 splice site probably benign
R0367:Cfap44 UTSW 16 44433476 critical splice donor site probably null
R0452:Cfap44 UTSW 16 44431945 missense probably benign 0.01
R0531:Cfap44 UTSW 16 44401426 start codon destroyed probably benign 0.01
R0722:Cfap44 UTSW 16 44404676 missense possibly damaging 0.94
R0801:Cfap44 UTSW 16 44422486 missense probably benign 0.41
R1209:Cfap44 UTSW 16 44422417 missense possibly damaging 0.86
R1215:Cfap44 UTSW 16 44419303 missense probably damaging 1.00
R1385:Cfap44 UTSW 16 44470775 missense probably damaging 1.00
R1400:Cfap44 UTSW 16 44421212 missense probably benign 0.01
R1415:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R1475:Cfap44 UTSW 16 44433812 splice site probably benign
R1901:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1902:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1903:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R2023:Cfap44 UTSW 16 44416012 missense probably benign 0.01
R2126:Cfap44 UTSW 16 44410475 missense probably benign 0.40
R2147:Cfap44 UTSW 16 44451684 missense probably benign 0.31
R2233:Cfap44 UTSW 16 44451525 missense probably benign 0.01
R2439:Cfap44 UTSW 16 44481246 unclassified probably benign
R3015:Cfap44 UTSW 16 44410469 missense probably benign 0.40
R4178:Cfap44 UTSW 16 44451853 missense possibly damaging 0.81
R4421:Cfap44 UTSW 16 44422437 missense probably damaging 1.00
R4516:Cfap44 UTSW 16 44473864 nonsense probably null
R4742:Cfap44 UTSW 16 44449252 intron probably null
R4766:Cfap44 UTSW 16 44415883 splice site probably null
R4810:Cfap44 UTSW 16 44451535 missense probably damaging 0.99
R4955:Cfap44 UTSW 16 44475277 missense possibly damaging 0.75
R5058:Cfap44 UTSW 16 44420204 splice site probably null
R5164:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R5172:Cfap44 UTSW 16 44449193 missense probably benign
R5344:Cfap44 UTSW 16 44416400 critical splice donor site probably null
R5519:Cfap44 UTSW 16 44404088 missense probably damaging 1.00
R5572:Cfap44 UTSW 16 44481305 missense possibly damaging 0.95
R5601:Cfap44 UTSW 16 44460186 missense probably damaging 1.00
R5625:Cfap44 UTSW 16 44460347 unclassified probably null
R5638:Cfap44 UTSW 16 44455531 missense possibly damaging 0.94
R5727:Cfap44 UTSW 16 44435442 missense probably damaging 0.98
R5950:Cfap44 UTSW 16 44479847 missense probably damaging 0.99
R6057:Cfap44 UTSW 16 44449097 missense probably benign 0.03
R6063:Cfap44 UTSW 16 44429892 missense probably benign 0.00
R6221:Cfap44 UTSW 16 44437186 missense probably benign 0.13
R6277:Cfap44 UTSW 16 44437306 missense probably benign 0.04
R6322:Cfap44 UTSW 16 44433666 nonsense probably null
R6836:Cfap44 UTSW 16 44404079 missense probably damaging 0.99
R6854:Cfap44 UTSW 16 44449028 critical splice acceptor site probably null
R6889:Cfap44 UTSW 16 44404132 missense probably benign 0.03
R7233:Cfap44 UTSW 16 44422408 missense probably damaging 0.99
R7294:Cfap44 UTSW 16 44404893 intron probably benign
R7332:Cfap44 UTSW 16 44429828 missense probably damaging 1.00
R7410:Cfap44 UTSW 16 44468413 missense probably damaging 1.00
R7455:Cfap44 UTSW 16 44404784 intron probably benign
R7456:Cfap44 UTSW 16 44431942 missense probably benign 0.07
R7491:Cfap44 UTSW 16 44470748 missense probably damaging 1.00
R7587:Cfap44 UTSW 16 44404106 missense probably benign 0.02
R7698:Cfap44 UTSW 16 44433786 missense probably damaging 0.99
R7717:Cfap44 UTSW 16 44429935 missense probably damaging 0.97
R8043:Cfap44 UTSW 16 44413691 missense probably benign 0.00
V1662:Cfap44 UTSW 16 44449138 nonsense probably null
X0060:Cfap44 UTSW 16 44449074 missense possibly damaging 0.83
Z1088:Cfap44 UTSW 16 44401466 missense probably damaging 0.98
Z1177:Cfap44 UTSW 16 44432044 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACGTGTTTTAAGCGTGAGGC -3'
(R):5'- ACCTGGGGAAATATTAAGTCACGG -3'

Sequencing Primer
(F):5'- GGCTTTAGCGGATGTGTAAAAAG -3'
(R):5'- TATTAAGTCACGGGGCAGGACC -3'
Posted On2019-06-26