Incidental Mutation 'R7298:Retnlg'
ID566824
Institutional Source Beutler Lab
Gene Symbol Retnlg
Ensembl Gene ENSMUSG00000022651
Gene Nameresistin like gamma
SynonymsFizz3, Relmg, Xcp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7298 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location48872621-48874496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48872874 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 5 (N5D)
Ref Sequence ENSEMBL: ENSMUSP00000070238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065666]
Predicted Effect probably benign
Transcript: ENSMUST00000065666
AA Change: N5D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070238
Gene: ENSMUSG00000022651
AA Change: N5D

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:Resistin 29 116 1.6e-38 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,883 T51S probably benign Het
Abcc1 A G 16: 14,396,472 D204G possibly damaging Het
Acaa1b C T 9: 119,151,847 E172K probably benign Het
Adamts5 G A 16: 85,899,918 T117I probably benign Het
Agmat A G 4: 141,746,964 E52G possibly damaging Het
Alg9 C T 9: 50,779,061 A121V probably damaging Het
Atf7ip2 T C 16: 10,209,168 I100T possibly damaging Het
Calm2 T C 17: 87,442,737 probably null Het
Cfap44 A T 16: 44,481,412 M1838L probably benign Het
Cym A G 3: 107,219,693 Y49H probably benign Het
Dchs1 G A 7: 105,755,131 R2735* probably null Het
Dnajc6 T C 4: 101,606,611 I187T probably benign Het
Fam151a G T 4: 106,735,528 R69L possibly damaging Het
Gm13089 C A 4: 143,698,505 D123Y probably benign Het
Gm14548 T A 7: 3,895,265 I353F possibly damaging Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm9922 C A 14: 101,729,525 G97V unknown Het
Hacl1 A T 14: 31,616,486 M378K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-82 A T 12: 115,952,954 I6N possibly damaging Het
Kctd19 A C 8: 105,382,984 V942G probably benign Het
Lce1l C T 3: 92,850,176 C125Y unknown Het
Mmp8 T C 9: 7,560,448 F42S probably damaging Het
Myom2 T C 8: 15,098,411 L529P probably damaging Het
Nectin3 A T 16: 46,448,396 Y548N probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1255 T C 2: 89,816,521 F59S probably damaging Het
Olfr303 T A 7: 86,394,923 T192S probably damaging Het
Otof T A 5: 30,388,270 I514F probably damaging Het
Plch1 G T 3: 63,716,037 S603* probably null Het
Ppa1 T A 10: 61,666,912 D171E probably benign Het
Prss34 T C 17: 25,299,763 C240R probably damaging Het
Ptpre A G 7: 135,683,287 D714G probably damaging Het
Ranbp9 A G 13: 43,480,460 F157L probably benign Het
Rbbp6 A G 7: 123,001,194 K1475E unknown Het
Rev1 T C 1: 38,053,104 T1245A probably damaging Het
Rngtt G T 4: 33,362,927 L360F probably damaging Het
Scrib A C 15: 76,064,761 V447G probably damaging Het
Slc22a6 C A 19: 8,621,320 A247E possibly damaging Het
Slc25a20 G A 9: 108,662,144 probably benign Het
Spag16 T A 1: 69,919,426 probably null Het
Stx3 C T 19: 11,790,048 W87* probably null Het
Syngap1 T A 17: 26,962,987 M1158K possibly damaging Het
Tmed9 C A 13: 55,593,294 H41N possibly damaging Het
Trav15-2-dv6-2 G A 14: 53,649,785 S54N probably benign Het
Tyk2 C T 9: 21,108,860 V1001I probably benign Het
Ugt8a A G 3: 125,915,416 V15A probably benign Het
Uhrf2 A G 19: 30,088,549 E661G probably benign Het
Vmn2r77 T A 7: 86,800,771 I75N probably benign Het
Zfp346 T G 13: 55,130,603 V258G probably damaging Het
Zfp72 T A 13: 74,372,394 K188N possibly damaging Het
Zgrf1 C A 3: 127,583,650 S848* probably null Het
Other mutations in Retnlg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Retnlg APN 16 48874325 missense possibly damaging 0.89
IGL02500:Retnlg APN 16 48872960 missense probably benign 0.16
IGL02588:Retnlg APN 16 48872892 missense probably benign 0.07
IGL03206:Retnlg APN 16 48874292 missense probably damaging 1.00
R1165:Retnlg UTSW 16 48873654 missense possibly damaging 0.76
R1751:Retnlg UTSW 16 48873628 missense possibly damaging 0.54
R1767:Retnlg UTSW 16 48873628 missense possibly damaging 0.54
R1796:Retnlg UTSW 16 48874247 missense probably benign 0.06
R2037:Retnlg UTSW 16 48874252 missense probably damaging 1.00
R4780:Retnlg UTSW 16 48874334 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TAAAGCATCTCATCTGGCCAG -3'
(R):5'- GTCAGCATCAGCAAAAGCTC -3'

Sequencing Primer
(F):5'- CCTGAGATTCTGGTAAGTCAGTCATC -3'
(R):5'- GCATCAGCAAAAGCTCAAACTATG -3'
Posted On2019-06-26