Mutagenetix > Incidental Mutation

Incidental Mutation 'R7298:Adamts5'

566825

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

045402-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.267) question?

Stock #

R7298 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 85899918 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 117 (T117I)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

AlphaFold

Q9R001

Predicted Effect

probably benign
Transcript: ENSMUST00000023611
AA Change: T117I

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: T117I

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	T	7: 120,207,883	T51S	probably benign	Het
Abcc1	A	G	16: 14,396,472	D204G	possibly damaging	Het
Acaa1b	C	T	9: 119,151,847	E172K	probably benign	Het
Agmat	A	G	4: 141,746,964	E52G	possibly damaging	Het
Alg9	C	T	9: 50,779,061	A121V	probably damaging	Het
Atf7ip2	T	C	16: 10,209,168	I100T	possibly damaging	Het
Calm2	T	C	17: 87,442,737		probably null	Het
Cfap44	A	T	16: 44,481,412	M1838L	probably benign	Het
Cym	A	G	3: 107,219,693	Y49H	probably benign	Het
Dchs1	G	A	7: 105,755,131	R2735*	probably null	Het
Dnajc6	T	C	4: 101,606,611	I187T	probably benign	Het
Fam151a	G	T	4: 106,735,528	R69L	possibly damaging	Het
Gm13089	C	A	4: 143,698,505	D123Y	probably benign	Het
Gm14548	T	A	7: 3,895,265	I353F	possibly damaging	Het
Gm4779	TCGGGGCCGGGGCCGGGGCCG	TCGGGGCCGGGGCCGGGGCCGGGGCCG	X: 101,794,171		probably benign	Het
Gm9922	C	A	14: 101,729,525	G97V	unknown	Het
Hacl1	A	T	14: 31,616,486	M378K	probably damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ighv1-82	A	T	12: 115,952,954	I6N	possibly damaging	Het
Kctd19	A	C	8: 105,382,984	V942G	probably benign	Het
Lce1l	C	T	3: 92,850,176	C125Y	unknown	Het
Mmp8	T	C	9: 7,560,448	F42S	probably damaging	Het
Myom2	T	C	8: 15,098,411	L529P	probably damaging	Het
Nectin3	A	T	16: 46,448,396	Y548N	probably damaging	Het
Olfml3	T	C	3: 103,735,860	K402E	probably damaging	Het
Olfr1255	T	C	2: 89,816,521	F59S	probably damaging	Het
Olfr303	T	A	7: 86,394,923	T192S	probably damaging	Het
Otof	T	A	5: 30,388,270	I514F	probably damaging	Het
Plch1	G	T	3: 63,716,037	S603*	probably null	Het
Ppa1	T	A	10: 61,666,912	D171E	probably benign	Het
Prss34	T	C	17: 25,299,763	C240R	probably damaging	Het
Ptpre	A	G	7: 135,683,287	D714G	probably damaging	Het
Ranbp9	A	G	13: 43,480,460	F157L	probably benign	Het
Rbbp6	A	G	7: 123,001,194	K1475E	unknown	Het
Retnlg	A	G	16: 48,872,874	N5D	probably benign	Het
Rev1	T	C	1: 38,053,104	T1245A	probably damaging	Het
Rngtt	G	T	4: 33,362,927	L360F	probably damaging	Het
Scrib	A	C	15: 76,064,761	V447G	probably damaging	Het
Slc22a6	C	A	19: 8,621,320	A247E	possibly damaging	Het
Slc25a20	G	A	9: 108,662,144		probably benign	Het
Spag16	T	A	1: 69,919,426		probably null	Het
Stx3	C	T	19: 11,790,048	W87*	probably null	Het
Syngap1	T	A	17: 26,962,987	M1158K	possibly damaging	Het
Tmed9	C	A	13: 55,593,294	H41N	possibly damaging	Het
Trav15-2-dv6-2	G	A	14: 53,649,785	S54N	probably benign	Het
Tyk2	C	T	9: 21,108,860	V1001I	probably benign	Het
Ugt8a	A	G	3: 125,915,416	V15A	probably benign	Het
Uhrf2	A	G	19: 30,088,549	E661G	probably benign	Het
Vmn2r77	T	A	7: 86,800,771	I75N	probably benign	Het
Zfp346	T	G	13: 55,130,603	V258G	probably damaging	Het
Zfp72	T	A	13: 74,372,394	K188N	possibly damaging	Het
Zgrf1	C	A	3: 127,583,650	S848*	probably null	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8370:Adamts5	UTSW	16	85899993	missense	possibly damaging	0.74
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
R8804:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R9209:Adamts5	UTSW	16	85870083	missense	probably damaging	1.00
R9455:Adamts5	UTSW	16	85870129	missense	probably damaging	0.99
R9616:Adamts5	UTSW	16	85862786	missense	probably benign	0.34
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTGTAGACATGCAGGATGC -3'
(R):5'- CCATTTACAACCCTTGGCCG -3'

Sequencing Primer
(F):5'- ATAAATTCGTTCATACTCTGCCCAGG -3'
(R):5'- AGTGGGCTACCTTGTCTA -3'

Posted On

2019-06-26