Incidental Mutation 'R7298:Slc22a6'
ID566828
Institutional Source Beutler Lab
Gene Symbol Slc22a6
Ensembl Gene ENSMUSG00000024650
Gene Namesolute carrier family 22 (organic anion transporter), member 6
SynonymsNKT, Oat1, mOat1, Orctl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7298 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8617996-8628299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8621320 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 247 (A247E)
Ref Sequence ENSEMBL: ENSMUSP00000010250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010250]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010250
AA Change: A247E

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000010250
Gene: ENSMUSG00000024650
AA Change: A247E

DomainStartEndE-ValueType
Pfam:MFS_1 107 467 2.4e-25 PFAM
Pfam:Sugar_tr 107 512 8e-33 PFAM
low complexity region 520 531 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the sodium-dependent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and may be localized to the basolateral membrane. Four transcript variants encoding four different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene may result in increased thymus weight or impaired renal organic anion excretion for a subset of organic anions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,883 T51S probably benign Het
Abcc1 A G 16: 14,396,472 D204G possibly damaging Het
Acaa1b C T 9: 119,151,847 E172K probably benign Het
Adamts5 G A 16: 85,899,918 T117I probably benign Het
Agmat A G 4: 141,746,964 E52G possibly damaging Het
Alg9 C T 9: 50,779,061 A121V probably damaging Het
Atf7ip2 T C 16: 10,209,168 I100T possibly damaging Het
Calm2 T C 17: 87,442,737 probably null Het
Cfap44 A T 16: 44,481,412 M1838L probably benign Het
Cym A G 3: 107,219,693 Y49H probably benign Het
Dchs1 G A 7: 105,755,131 R2735* probably null Het
Dnajc6 T C 4: 101,606,611 I187T probably benign Het
Fam151a G T 4: 106,735,528 R69L possibly damaging Het
Gm13089 C A 4: 143,698,505 D123Y probably benign Het
Gm14548 T A 7: 3,895,265 I353F possibly damaging Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm9922 C A 14: 101,729,525 G97V unknown Het
Hacl1 A T 14: 31,616,486 M378K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-82 A T 12: 115,952,954 I6N possibly damaging Het
Kctd19 A C 8: 105,382,984 V942G probably benign Het
Lce1l C T 3: 92,850,176 C125Y unknown Het
Mmp8 T C 9: 7,560,448 F42S probably damaging Het
Myom2 T C 8: 15,098,411 L529P probably damaging Het
Nectin3 A T 16: 46,448,396 Y548N probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1255 T C 2: 89,816,521 F59S probably damaging Het
Olfr303 T A 7: 86,394,923 T192S probably damaging Het
Otof T A 5: 30,388,270 I514F probably damaging Het
Plch1 G T 3: 63,716,037 S603* probably null Het
Ppa1 T A 10: 61,666,912 D171E probably benign Het
Prss34 T C 17: 25,299,763 C240R probably damaging Het
Ptpre A G 7: 135,683,287 D714G probably damaging Het
Ranbp9 A G 13: 43,480,460 F157L probably benign Het
Rbbp6 A G 7: 123,001,194 K1475E unknown Het
Retnlg A G 16: 48,872,874 N5D probably benign Het
Rev1 T C 1: 38,053,104 T1245A probably damaging Het
Rngtt G T 4: 33,362,927 L360F probably damaging Het
Scrib A C 15: 76,064,761 V447G probably damaging Het
Slc25a20 G A 9: 108,662,144 probably benign Het
Spag16 T A 1: 69,919,426 probably null Het
Stx3 C T 19: 11,790,048 W87* probably null Het
Syngap1 T A 17: 26,962,987 M1158K possibly damaging Het
Tmed9 C A 13: 55,593,294 H41N possibly damaging Het
Trav15-2-dv6-2 G A 14: 53,649,785 S54N probably benign Het
Tyk2 C T 9: 21,108,860 V1001I probably benign Het
Ugt8a A G 3: 125,915,416 V15A probably benign Het
Uhrf2 A G 19: 30,088,549 E661G probably benign Het
Vmn2r77 T A 7: 86,800,771 I75N probably benign Het
Zfp346 T G 13: 55,130,603 V258G probably damaging Het
Zfp72 T A 13: 74,372,394 K188N possibly damaging Het
Zgrf1 C A 3: 127,583,650 S848* probably null Het
Other mutations in Slc22a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc22a6 APN 19 8621868 missense probably benign 0.14
IGL00825:Slc22a6 APN 19 8618357 missense possibly damaging 0.94
IGL01362:Slc22a6 APN 19 8621208 missense possibly damaging 0.69
IGL01843:Slc22a6 APN 19 8626214 utr 3 prime probably benign
IGL02583:Slc22a6 APN 19 8623616 missense possibly damaging 0.79
R1004:Slc22a6 UTSW 19 8618399 missense probably damaging 1.00
R1775:Slc22a6 UTSW 19 8619107 critical splice donor site probably null
R1911:Slc22a6 UTSW 19 8621882 missense probably benign
R2365:Slc22a6 UTSW 19 8619397 missense probably benign
R3406:Slc22a6 UTSW 19 8621311 missense probably damaging 1.00
R4106:Slc22a6 UTSW 19 8618510 missense probably benign
R4693:Slc22a6 UTSW 19 8623652 missense probably damaging 1.00
R5094:Slc22a6 UTSW 19 8626177 missense probably damaging 1.00
R5347:Slc22a6 UTSW 19 8618553 missense possibly damaging 0.94
R5360:Slc22a6 UTSW 19 8619422 missense probably damaging 1.00
R5667:Slc22a6 UTSW 19 8621784 critical splice acceptor site probably null
R5810:Slc22a6 UTSW 19 8623858 missense probably damaging 1.00
R6176:Slc22a6 UTSW 19 8621797 missense probably damaging 1.00
R6336:Slc22a6 UTSW 19 8622130 missense probably benign 0.02
R6864:Slc22a6 UTSW 19 8618441 missense probably damaging 1.00
R6954:Slc22a6 UTSW 19 8622096 missense probably benign 0.02
R7305:Slc22a6 UTSW 19 8622158 critical splice donor site probably null
R7681:Slc22a6 UTSW 19 8626129 missense probably benign 0.03
R7749:Slc22a6 UTSW 19 8621896 missense possibly damaging 0.48
Z1088:Slc22a6 UTSW 19 8621833 missense probably benign 0.03
Z1176:Slc22a6 UTSW 19 8623543 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCCCATCTAGCAGCCCAATG -3'
(R):5'- TTCCTTCAGGGCAAAACCTACC -3'

Sequencing Primer
(F):5'- TCTAGCAGCCCAATGACTCC -3'
(R):5'- CTTGGCTTCAGAATCTACTCAACAG -3'
Posted On2019-06-26