Incidental Mutation 'R0636:Zfp882'
ID 56685
Institutional Source Beutler Lab
Gene Symbol Zfp882
Ensembl Gene ENSMUSG00000089857
Gene Name zinc finger protein 882
Synonyms ENSMUSG00000052439
MMRRC Submission 038825-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R0636 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 72662452-72670198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72668181 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 336 (V336A)
Ref Sequence ENSEMBL: ENSMUSP00000105629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110002] [ENSMUST00000125802] [ENSMUST00000126607] [ENSMUST00000131544]
AlphaFold E9Q4R4
Predicted Effect probably benign
Transcript: ENSMUST00000110002
AA Change: V336A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105629
Gene: ENSMUSG00000089857
AA Change: V336A

DomainStartEndE-ValueType
KRAB 4 61 8.58e-14 SMART
ZnF_C2H2 84 106 1.47e-3 SMART
ZnF_C2H2 168 190 8.47e-4 SMART
ZnF_C2H2 196 218 2.27e-4 SMART
ZnF_C2H2 224 246 6.31e1 SMART
ZnF_C2H2 251 273 1.16e-1 SMART
ZnF_C2H2 279 301 1.25e-1 SMART
ZnF_C2H2 307 329 5.42e-2 SMART
ZnF_C2H2 335 357 1.47e-3 SMART
ZnF_C2H2 363 385 7.26e-3 SMART
ZnF_C2H2 391 413 1.26e-2 SMART
ZnF_C2H2 419 441 3.29e1 SMART
ZnF_C2H2 447 469 2.67e-1 SMART
ZnF_C2H2 475 497 1.04e-3 SMART
ZnF_C2H2 503 525 4.11e-2 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118290
Predicted Effect probably benign
Transcript: ENSMUST00000125802
SMART Domains Protein: ENSMUSP00000121316
Gene: ENSMUSG00000089857

DomainStartEndE-ValueType
KRAB 12 69 8.58e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126607
SMART Domains Protein: ENSMUSP00000119978
Gene: ENSMUSG00000089857

DomainStartEndE-ValueType
KRAB 44 101 8.58e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131544
SMART Domains Protein: ENSMUSP00000120213
Gene: ENSMUSG00000066880

DomainStartEndE-ValueType
KRAB 4 56 1.08e-10 SMART
ZnF_C2H2 167 189 8.47e-4 SMART
ZnF_C2H2 195 217 8.34e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170898
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 96% (74/77)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,088,414 (GRCm39) Y264C probably damaging Het
8030423J24Rik T C 13: 71,032,344 (GRCm39) F139L unknown Het
Aco1 A G 4: 40,175,697 (GRCm39) E146G probably damaging Het
Adam2 T G 14: 66,272,265 (GRCm39) D639A probably benign Het
Adh4 G T 3: 138,133,835 (GRCm39) R315L probably damaging Het
Adprhl1 T C 8: 13,298,702 (GRCm39) D76G probably damaging Het
Akip1 T C 7: 109,306,726 (GRCm39) probably benign Het
Ap3d1 T A 10: 80,555,216 (GRCm39) K370* probably null Het
Arfgef1 C A 1: 10,270,076 (GRCm39) V358L probably benign Het
Arpp21 A T 9: 112,012,566 (GRCm39) D85E probably benign Het
Azi2 A T 9: 117,891,125 (GRCm39) L383F probably benign Het
Bpgm T A 6: 34,481,222 (GRCm39) D206E probably benign Het
Bsn T C 9: 107,985,033 (GRCm39) D3007G unknown Het
Ccdc142 T G 6: 83,084,179 (GRCm39) probably benign Het
Cep135 T C 5: 76,763,504 (GRCm39) V498A probably benign Het
Cntn6 A T 6: 104,840,109 (GRCm39) Q1003L probably benign Het
Cntnap2 T A 6: 47,273,642 (GRCm39) probably benign Het
Csf2rb2 G A 15: 78,176,160 (GRCm39) Q139* probably null Het
Cyp3a16 A G 5: 145,399,895 (GRCm39) V101A probably benign Het
D630045J12Rik T C 6: 38,173,713 (GRCm39) T152A probably benign Het
Def8 G A 8: 124,181,096 (GRCm39) W176* probably null Het
Dgkg A G 16: 22,398,479 (GRCm39) probably benign Het
Ear10 T C 14: 44,160,451 (GRCm39) probably null Het
Fbxw2 A T 2: 34,712,859 (GRCm39) Y67* probably null Het
Flii T A 11: 60,606,378 (GRCm39) Y1104F probably damaging Het
Gm973 G A 1: 59,590,303 (GRCm39) R270K probably benign Het
Gnl3 T A 14: 30,739,110 (GRCm39) K75N probably damaging Het
Gpc6 A T 14: 117,861,905 (GRCm39) M274L probably benign Het
Ifi47 A G 11: 48,987,478 (GRCm39) E415G possibly damaging Het
Ift57 A G 16: 49,532,259 (GRCm39) T130A probably benign Het
Itpr2 T A 6: 146,072,910 (GRCm39) D2373V probably damaging Het
Kat6a T C 8: 23,429,339 (GRCm39) S1565P possibly damaging Het
Klhl6 A T 16: 19,766,823 (GRCm39) probably benign Het
Klra2 T C 6: 131,197,067 (GRCm39) probably benign Het
Lama5 A G 2: 179,831,124 (GRCm39) probably null Het
Mapk4 A G 18: 74,063,525 (GRCm39) S566P probably benign Het
Mindy4 C A 6: 55,253,570 (GRCm39) R480S possibly damaging Het
Mterf3 T C 13: 67,070,817 (GRCm39) probably benign Het
Mtmr2 A G 9: 13,713,209 (GRCm39) probably null Het
Myef2l T C 3: 10,153,843 (GRCm39) L204P possibly damaging Het
Naip5 T C 13: 100,356,196 (GRCm39) T1140A probably benign Het
Nf1 A G 11: 79,426,529 (GRCm39) T1648A probably damaging Het
Nlk A T 11: 78,586,670 (GRCm39) D141E probably benign Het
Noxa1 C A 2: 24,976,106 (GRCm39) probably benign Het
Or4g16 A G 2: 111,136,757 (GRCm39) N69S probably benign Het
Or5b121 A T 19: 13,507,613 (GRCm39) Y236F possibly damaging Het
Or5p55 T C 7: 107,566,679 (GRCm39) V25A probably benign Het
Otog G A 7: 45,913,652 (GRCm39) probably null Het
Pebp4 T C 14: 70,285,796 (GRCm39) probably benign Het
Phgdh G T 3: 98,240,607 (GRCm39) N100K possibly damaging Het
Pnisr T A 4: 21,873,800 (GRCm39) probably benign Het
Ptpn6 T C 6: 124,702,242 (GRCm39) H346R probably benign Het
Rsf1 T C 7: 97,311,226 (GRCm39) V652A possibly damaging Het
Rubcn G A 16: 32,649,056 (GRCm39) H624Y probably damaging Het
Semp2l2a T C 8: 13,887,870 (GRCm39) R74G probably benign Het
Setdb2 T C 14: 59,644,153 (GRCm39) N656D probably benign Het
Slc22a23 T C 13: 34,483,076 (GRCm39) T268A probably benign Het
Slc3a1 A T 17: 85,340,222 (GRCm39) T215S possibly damaging Het
Srsf2 A G 11: 116,742,904 (GRCm39) S206P probably benign Het
Susd2 T A 10: 75,475,184 (GRCm39) D542V probably damaging Het
Svep1 G A 4: 58,073,121 (GRCm39) Q2063* probably null Het
Syne2 G A 12: 75,977,757 (GRCm39) V1401M possibly damaging Het
Tenm2 A G 11: 36,834,803 (GRCm39) L64P probably damaging Het
Tigd2 A G 6: 59,188,272 (GRCm39) T380A possibly damaging Het
Trmt12 G T 15: 58,745,834 (GRCm39) V411F probably damaging Het
Ubr4 T C 4: 139,163,613 (GRCm39) probably null Het
Ush2a G A 1: 188,554,935 (GRCm39) C3571Y probably benign Het
Usp8 A G 2: 126,562,030 (GRCm39) M75V possibly damaging Het
Vcan C T 13: 89,852,825 (GRCm39) D712N probably damaging Het
Vcan C A 13: 89,860,386 (GRCm39) R327L probably damaging Het
Vps8 A G 16: 21,253,683 (GRCm39) E8G probably benign Het
Washc5 T C 15: 59,231,258 (GRCm39) D335G probably benign Het
Zbtb39 A G 10: 127,578,704 (GRCm39) N426S probably benign Het
Zfp184 T A 13: 22,133,919 (GRCm39) D55E probably damaging Het
Other mutations in Zfp882
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Zfp882 APN 8 72,667,671 (GRCm39) missense probably benign
R0244:Zfp882 UTSW 8 72,667,367 (GRCm39) missense possibly damaging 0.79
R0270:Zfp882 UTSW 8 72,668,459 (GRCm39) missense probably benign 0.05
R0840:Zfp882 UTSW 8 72,668,530 (GRCm39) nonsense probably null
R1299:Zfp882 UTSW 8 72,667,317 (GRCm39) missense probably damaging 1.00
R4439:Zfp882 UTSW 8 72,667,453 (GRCm39) missense probably damaging 0.97
R4829:Zfp882 UTSW 8 72,668,233 (GRCm39) missense probably damaging 1.00
R5028:Zfp882 UTSW 8 72,668,498 (GRCm39) missense possibly damaging 0.70
R5296:Zfp882 UTSW 8 72,668,204 (GRCm39) missense probably damaging 1.00
R5882:Zfp882 UTSW 8 72,667,303 (GRCm39) critical splice acceptor site probably null
R5974:Zfp882 UTSW 8 72,666,999 (GRCm39) missense probably damaging 1.00
R6052:Zfp882 UTSW 8 72,668,349 (GRCm39) missense probably benign 0.01
R6383:Zfp882 UTSW 8 72,668,484 (GRCm39) missense probably damaging 1.00
R6888:Zfp882 UTSW 8 72,668,130 (GRCm39) missense probably benign 0.01
R6987:Zfp882 UTSW 8 72,668,517 (GRCm39) missense probably benign 0.01
R7045:Zfp882 UTSW 8 72,667,093 (GRCm39) critical splice donor site probably null
R7780:Zfp882 UTSW 8 72,668,073 (GRCm39) missense possibly damaging 0.89
R7793:Zfp882 UTSW 8 72,666,985 (GRCm39) missense probably damaging 1.00
R8386:Zfp882 UTSW 8 72,667,962 (GRCm39) missense probably benign 0.00
R9452:Zfp882 UTSW 8 72,668,831 (GRCm39) missense probably damaging 1.00
R9694:Zfp882 UTSW 8 72,667,915 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACTCTTGCTGGTATTCAACAGCAC -3'
(R):5'- TTTCCCACACTGCTTACAGCCATAG -3'

Sequencing Primer
(F):5'- gccttttactcttccagttctttc -3'
(R):5'- GGCCTTCTCTCCCCTGTG -3'
Posted On 2013-07-11