Incidental Mutation 'R0636:Zfp882'
ID 56685
Institutional Source Beutler Lab
Gene Symbol Zfp882
Ensembl Gene ENSMUSG00000089857
Gene Name zinc finger protein 882
Synonyms ENSMUSG00000052439
MMRRC Submission 038825-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock # R0636 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 71908608-71916354 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71914337 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 336 (V336A)
Ref Sequence ENSEMBL: ENSMUSP00000105629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110002] [ENSMUST00000125802] [ENSMUST00000126607] [ENSMUST00000131544]
AlphaFold E9Q4R4
Predicted Effect probably benign
Transcript: ENSMUST00000110002
AA Change: V336A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105629
Gene: ENSMUSG00000089857
AA Change: V336A

KRAB 4 61 8.58e-14 SMART
ZnF_C2H2 84 106 1.47e-3 SMART
ZnF_C2H2 168 190 8.47e-4 SMART
ZnF_C2H2 196 218 2.27e-4 SMART
ZnF_C2H2 224 246 6.31e1 SMART
ZnF_C2H2 251 273 1.16e-1 SMART
ZnF_C2H2 279 301 1.25e-1 SMART
ZnF_C2H2 307 329 5.42e-2 SMART
ZnF_C2H2 335 357 1.47e-3 SMART
ZnF_C2H2 363 385 7.26e-3 SMART
ZnF_C2H2 391 413 1.26e-2 SMART
ZnF_C2H2 419 441 3.29e1 SMART
ZnF_C2H2 447 469 2.67e-1 SMART
ZnF_C2H2 475 497 1.04e-3 SMART
ZnF_C2H2 503 525 4.11e-2 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118290
Predicted Effect probably benign
Transcript: ENSMUST00000125802
SMART Domains Protein: ENSMUSP00000121316
Gene: ENSMUSG00000089857

KRAB 12 69 8.58e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126607
SMART Domains Protein: ENSMUSP00000119978
Gene: ENSMUSG00000089857

KRAB 44 101 8.58e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131544
SMART Domains Protein: ENSMUSP00000120213
Gene: ENSMUSG00000066880

KRAB 4 56 1.08e-10 SMART
ZnF_C2H2 167 189 8.47e-4 SMART
ZnF_C2H2 195 217 8.34e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170898
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 96% (74/77)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,231,217 Y264C probably damaging Het
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Aco1 A G 4: 40,175,697 E146G probably damaging Het
Adam2 T G 14: 66,034,816 D639A probably benign Het
Adh4 G T 3: 138,428,074 R315L probably damaging Het
Adprhl1 T C 8: 13,248,702 D76G probably damaging Het
AF366264 T C 8: 13,837,870 R74G probably benign Het
Akip1 T C 7: 109,707,519 probably benign Het
Ap3d1 T A 10: 80,719,382 K370* probably null Het
Arfgef1 C A 1: 10,199,851 V358L probably benign Het
Arpp21 A T 9: 112,183,498 D85E probably benign Het
Azi2 A T 9: 118,062,057 L383F probably benign Het
Bpgm T A 6: 34,504,287 D206E probably benign Het
Bsn T C 9: 108,107,834 D3007G unknown Het
Ccdc142 T G 6: 83,107,198 probably benign Het
Cep135 T C 5: 76,615,657 V498A probably benign Het
Cntn6 A T 6: 104,863,148 Q1003L probably benign Het
Cntnap2 T A 6: 47,296,708 probably benign Het
Csf2rb2 G A 15: 78,291,960 Q139* probably null Het
Cyp3a16 A G 5: 145,463,085 V101A probably benign Het
D630045J12Rik T C 6: 38,196,778 T152A probably benign Het
Def8 G A 8: 123,454,357 W176* probably null Het
Dgkg A G 16: 22,579,729 probably benign Het
Ear10 T C 14: 43,922,994 probably null Het
Fbxw2 A T 2: 34,822,847 Y67* probably null Het
Flii T A 11: 60,715,552 Y1104F probably damaging Het
Gm973 G A 1: 59,551,144 R270K probably benign Het
Gm9833 T C 3: 10,088,783 L204P possibly damaging Het
Gnl3 T A 14: 31,017,153 K75N probably damaging Het
Gpc6 A T 14: 117,624,493 M274L probably benign Het
Ifi47 A G 11: 49,096,651 E415G possibly damaging Het
Ift57 A G 16: 49,711,896 T130A probably benign Het
Itpr2 T A 6: 146,171,412 D2373V probably damaging Het
Kat6a T C 8: 22,939,323 S1565P possibly damaging Het
Klhl6 A T 16: 19,948,073 probably benign Het
Klra2 T C 6: 131,220,104 probably benign Het
Lama5 A G 2: 180,189,331 probably null Het
Mapk4 A G 18: 73,930,454 S566P probably benign Het
Mindy4 C A 6: 55,276,585 R480S possibly damaging Het
Mterf3 T C 13: 66,922,753 probably benign Het
Mtmr2 A G 9: 13,801,913 probably null Het
Naip5 T C 13: 100,219,688 T1140A probably benign Het
Nf1 A G 11: 79,535,703 T1648A probably damaging Het
Nlk A T 11: 78,695,844 D141E probably benign Het
Noxa1 C A 2: 25,086,094 probably benign Het
Olfr1279 A G 2: 111,306,412 N69S probably benign Het
Olfr1480 A T 19: 13,530,249 Y236F possibly damaging Het
Olfr476 T C 7: 107,967,472 V25A probably benign Het
Otog G A 7: 46,264,228 probably null Het
Pebp4 T C 14: 70,048,347 probably benign Het
Phgdh G T 3: 98,333,291 N100K possibly damaging Het
Pnisr T A 4: 21,873,800 probably benign Het
Ptpn6 T C 6: 124,725,279 H346R probably benign Het
Rsf1 T C 7: 97,662,019 V652A possibly damaging Het
Rubcn G A 16: 32,828,686 H624Y probably damaging Het
Setdb2 T C 14: 59,406,704 N656D probably benign Het
Slc22a23 T C 13: 34,299,093 T268A probably benign Het
Slc3a1 A T 17: 85,032,794 T215S possibly damaging Het
Srsf2 A G 11: 116,852,078 S206P probably benign Het
Susd2 T A 10: 75,639,350 D542V probably damaging Het
Svep1 G A 4: 58,073,121 Q2063* probably null Het
Syne2 G A 12: 75,930,983 V1401M possibly damaging Het
Tenm2 A G 11: 36,943,976 L64P probably damaging Het
Tigd2 A G 6: 59,211,287 T380A possibly damaging Het
Trmt12 G T 15: 58,873,985 V411F probably damaging Het
Ubr4 T C 4: 139,436,302 probably null Het
Ush2a G A 1: 188,822,738 C3571Y probably benign Het
Usp8 A G 2: 126,720,110 M75V possibly damaging Het
Vcan C T 13: 89,704,706 D712N probably damaging Het
Vcan C A 13: 89,712,267 R327L probably damaging Het
Vps8 A G 16: 21,434,933 E8G probably benign Het
Washc5 T C 15: 59,359,409 D335G probably benign Het
Zbtb39 A G 10: 127,742,835 N426S probably benign Het
Zfp184 T A 13: 21,949,749 D55E probably damaging Het
Other mutations in Zfp882
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Zfp882 APN 8 71913827 missense probably benign
R0244:Zfp882 UTSW 8 71913523 missense possibly damaging 0.79
R0270:Zfp882 UTSW 8 71914615 missense probably benign 0.05
R0840:Zfp882 UTSW 8 71914686 nonsense probably null
R1299:Zfp882 UTSW 8 71913473 missense probably damaging 1.00
R4439:Zfp882 UTSW 8 71913609 missense probably damaging 0.97
R4829:Zfp882 UTSW 8 71914389 missense probably damaging 1.00
R5028:Zfp882 UTSW 8 71914654 missense possibly damaging 0.70
R5296:Zfp882 UTSW 8 71914360 missense probably damaging 1.00
R5882:Zfp882 UTSW 8 71913459 critical splice acceptor site probably null
R5974:Zfp882 UTSW 8 71913155 missense probably damaging 1.00
R6052:Zfp882 UTSW 8 71914505 missense probably benign 0.01
R6383:Zfp882 UTSW 8 71914640 missense probably damaging 1.00
R6888:Zfp882 UTSW 8 71914286 missense probably benign 0.01
R6987:Zfp882 UTSW 8 71914673 missense probably benign 0.01
R7045:Zfp882 UTSW 8 71913249 critical splice donor site probably null
R7780:Zfp882 UTSW 8 71914229 missense possibly damaging 0.89
R7793:Zfp882 UTSW 8 71913141 missense probably damaging 1.00
R8386:Zfp882 UTSW 8 71914118 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gccttttactcttccagttctttc -3'
Posted On 2013-07-11