Incidental Mutation 'R0636:Def8'
ID56686
Institutional Source Beutler Lab
Gene Symbol Def8
Ensembl Gene ENSMUSG00000001482
Gene Namedifferentially expressed in FDCP 8
SynonymsD8Ertd713e
MMRRC Submission 038825-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R0636 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123423527-123463270 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 123454357 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 176 (W176*)
Ref Sequence ENSEMBL: ENSMUSP00000115137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001522] [ENSMUST00000065534] [ENSMUST00000093049] [ENSMUST00000108830] [ENSMUST00000108832] [ENSMUST00000124741] [ENSMUST00000127664] [ENSMUST00000128424] [ENSMUST00000132063] [ENSMUST00000212391] [ENSMUST00000212827] [ENSMUST00000212883]
Predicted Effect probably null
Transcript: ENSMUST00000001522
AA Change: W176*
SMART Domains Protein: ENSMUSP00000001522
Gene: ENSMUSG00000001482
AA Change: W176*

DomainStartEndE-ValueType
Blast:DUF4206 77 133 8e-28 BLAST
C1 148 198 4.12e-3 SMART
DUF4206 243 447 4.01e-121 SMART
C1 385 437 1.5e0 SMART
RING 399 440 4.86e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065534
AA Change: W164*
SMART Domains Protein: ENSMUSP00000070579
Gene: ENSMUSG00000001482
AA Change: W164*

DomainStartEndE-ValueType
Blast:DUF4206 65 121 7e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 435 4.01e-121 SMART
C1 373 425 1.5e0 SMART
RING 387 428 4.86e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093049
AA Change: W164*
SMART Domains Protein: ENSMUSP00000090737
Gene: ENSMUSG00000001482
AA Change: W164*

DomainStartEndE-ValueType
Blast:DUF4206 65 121 9e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 429 6.85e-106 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108830
AA Change: W164*
SMART Domains Protein: ENSMUSP00000104458
Gene: ENSMUSG00000001482
AA Change: W164*

DomainStartEndE-ValueType
Blast:DUF4206 65 121 7e-28 BLAST
C1 136 186 4.12e-3 SMART
DUF4206 231 435 4.01e-121 SMART
C1 373 425 1.5e0 SMART
RING 387 428 4.86e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108832
AA Change: W188*
SMART Domains Protein: ENSMUSP00000104460
Gene: ENSMUSG00000001482
AA Change: W188*

DomainStartEndE-ValueType
Blast:DUF4206 89 145 9e-28 BLAST
C1 160 210 4.12e-3 SMART
DUF4206 255 459 4.01e-121 SMART
C1 397 449 1.5e0 SMART
RING 411 452 4.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124741
SMART Domains Protein: ENSMUSP00000122532
Gene: ENSMUSG00000001482

DomainStartEndE-ValueType
Blast:DUF4206 65 97 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128424
AA Change: W176*
SMART Domains Protein: ENSMUSP00000115137
Gene: ENSMUSG00000001482
AA Change: W176*

DomainStartEndE-ValueType
Blast:DUF4206 77 133 4e-30 BLAST
C1 148 198 4.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132063
Predicted Effect probably benign
Transcript: ENSMUST00000212391
Predicted Effect probably benign
Transcript: ENSMUST00000212827
Predicted Effect probably benign
Transcript: ENSMUST00000212883
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 96% (74/77)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,231,217 Y264C probably damaging Het
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Aco1 A G 4: 40,175,697 E146G probably damaging Het
Adam2 T G 14: 66,034,816 D639A probably benign Het
Adh4 G T 3: 138,428,074 R315L probably damaging Het
Adprhl1 T C 8: 13,248,702 D76G probably damaging Het
AF366264 T C 8: 13,837,870 R74G probably benign Het
Akip1 T C 7: 109,707,519 probably benign Het
Ap3d1 T A 10: 80,719,382 K370* probably null Het
Arfgef1 C A 1: 10,199,851 V358L probably benign Het
Arpp21 A T 9: 112,183,498 D85E probably benign Het
Azi2 A T 9: 118,062,057 L383F probably benign Het
Bpgm T A 6: 34,504,287 D206E probably benign Het
Bsn T C 9: 108,107,834 D3007G unknown Het
Ccdc142 T G 6: 83,107,198 probably benign Het
Cep135 T C 5: 76,615,657 V498A probably benign Het
Cntn6 A T 6: 104,863,148 Q1003L probably benign Het
Cntnap2 T A 6: 47,296,708 probably benign Het
Csf2rb2 G A 15: 78,291,960 Q139* probably null Het
Cyp3a16 A G 5: 145,463,085 V101A probably benign Het
D630045J12Rik T C 6: 38,196,778 T152A probably benign Het
Dgkg A G 16: 22,579,729 probably benign Het
Ear10 T C 14: 43,922,994 probably null Het
Fbxw2 A T 2: 34,822,847 Y67* probably null Het
Flii T A 11: 60,715,552 Y1104F probably damaging Het
Gm973 G A 1: 59,551,144 R270K probably benign Het
Gm9833 T C 3: 10,088,783 L204P possibly damaging Het
Gnl3 T A 14: 31,017,153 K75N probably damaging Het
Gpc6 A T 14: 117,624,493 M274L probably benign Het
Ifi47 A G 11: 49,096,651 E415G possibly damaging Het
Ift57 A G 16: 49,711,896 T130A probably benign Het
Itpr2 T A 6: 146,171,412 D2373V probably damaging Het
Kat6a T C 8: 22,939,323 S1565P possibly damaging Het
Klhl6 A T 16: 19,948,073 probably benign Het
Klra2 T C 6: 131,220,104 probably benign Het
Lama5 A G 2: 180,189,331 probably null Het
Mapk4 A G 18: 73,930,454 S566P probably benign Het
Mindy4 C A 6: 55,276,585 R480S possibly damaging Het
Mterf3 T C 13: 66,922,753 probably benign Het
Mtmr2 A G 9: 13,801,913 probably null Het
Naip5 T C 13: 100,219,688 T1140A probably benign Het
Nf1 A G 11: 79,535,703 T1648A probably damaging Het
Nlk A T 11: 78,695,844 D141E probably benign Het
Noxa1 C A 2: 25,086,094 probably benign Het
Olfr1279 A G 2: 111,306,412 N69S probably benign Het
Olfr1480 A T 19: 13,530,249 Y236F possibly damaging Het
Olfr476 T C 7: 107,967,472 V25A probably benign Het
Otog G A 7: 46,264,228 probably null Het
Pebp4 T C 14: 70,048,347 probably benign Het
Phgdh G T 3: 98,333,291 N100K possibly damaging Het
Pnisr T A 4: 21,873,800 probably benign Het
Ptpn6 T C 6: 124,725,279 H346R probably benign Het
Rsf1 T C 7: 97,662,019 V652A possibly damaging Het
Rubcn G A 16: 32,828,686 H624Y probably damaging Het
Setdb2 T C 14: 59,406,704 N656D probably benign Het
Slc22a23 T C 13: 34,299,093 T268A probably benign Het
Slc3a1 A T 17: 85,032,794 T215S possibly damaging Het
Srsf2 A G 11: 116,852,078 S206P probably benign Het
Susd2 T A 10: 75,639,350 D542V probably damaging Het
Svep1 G A 4: 58,073,121 Q2063* probably null Het
Syne2 G A 12: 75,930,983 V1401M possibly damaging Het
Tenm2 A G 11: 36,943,976 L64P probably damaging Het
Tigd2 A G 6: 59,211,287 T380A possibly damaging Het
Trmt12 G T 15: 58,873,985 V411F probably damaging Het
Ubr4 T C 4: 139,436,302 probably null Het
Ush2a G A 1: 188,822,738 C3571Y probably benign Het
Usp8 A G 2: 126,720,110 M75V possibly damaging Het
Vcan C T 13: 89,704,706 D712N probably damaging Het
Vcan C A 13: 89,712,267 R327L probably damaging Het
Vps8 A G 16: 21,434,933 E8G probably benign Het
Washc5 T C 15: 59,359,409 D335G probably benign Het
Zbtb39 A G 10: 127,742,835 N426S probably benign Het
Zfp184 T A 13: 21,949,749 D55E probably damaging Het
Zfp882 T C 8: 71,914,337 V336A probably benign Het
Other mutations in Def8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Def8 APN 8 123459650 missense possibly damaging 0.95
IGL01896:Def8 APN 8 123459895 missense probably benign 0.29
IGL02424:Def8 APN 8 123459648 missense possibly damaging 0.65
IGL02982:Def8 APN 8 123456539 unclassified probably benign
IGL03218:Def8 APN 8 123456436 missense probably damaging 1.00
defensive UTSW 8 123454322 missense probably damaging 1.00
PIT4495001:Def8 UTSW 8 123459553 missense probably benign 0.00
R0003:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0117:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0119:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0135:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0138:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0141:Def8 UTSW 8 123456495 missense probably damaging 0.98
R0408:Def8 UTSW 8 123459917 missense probably damaging 1.00
R3890:Def8 UTSW 8 123458344 unclassified probably benign
R3891:Def8 UTSW 8 123458344 unclassified probably benign
R3892:Def8 UTSW 8 123458344 unclassified probably benign
R4904:Def8 UTSW 8 123461480 missense probably damaging 0.96
R5930:Def8 UTSW 8 123460070 unclassified probably benign
R6088:Def8 UTSW 8 123460048 nonsense probably null
R6577:Def8 UTSW 8 123456710 missense probably benign 0.01
R7446:Def8 UTSW 8 123454322 missense probably damaging 1.00
R7498:Def8 UTSW 8 123447844 missense probably damaging 1.00
R7770:Def8 UTSW 8 123460059 missense unknown
R7827:Def8 UTSW 8 123447321 missense probably benign
R8186:Def8 UTSW 8 123461476 nonsense probably null
Z1088:Def8 UTSW 8 123456498 missense probably damaging 0.96
Z1176:Def8 UTSW 8 123459966 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GAGCTGCTGCTTACCTCACCTATG -3'
(R):5'- TAGAGAGATGCCCTTGGTCACCTC -3'

Sequencing Primer
(F):5'- ACCTCACCTATGACTTTTCCATTG -3'
(R):5'- accacatccttcctctttacatatac -3'
Posted On2013-07-11