Incidental Mutation 'R7299:Cnot7'
ID566867
Institutional Source Beutler Lab
Gene Symbol Cnot7
Ensembl Gene ENSMUSG00000031601
Gene NameCCR4-NOT transcription complex, subunit 7
SynonymsCaf1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.500) question?
Stock #R7299 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location40492540-40515847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40507545 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 74 (I74T)
Ref Sequence ENSEMBL: ENSMUSP00000034012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034012] [ENSMUST00000098817] [ENSMUST00000128166] [ENSMUST00000132032] [ENSMUST00000135269] [ENSMUST00000149992]
Predicted Effect probably damaging
Transcript: ENSMUST00000034012
AA Change: I74T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034012
Gene: ENSMUSG00000031601
AA Change: I74T

DomainStartEndE-ValueType
Pfam:CAF1 15 139 9.1e-15 PFAM
Pfam:CAF1 132 238 1.2e-14 PFAM
low complexity region 259 268 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098817
SMART Domains Protein: ENSMUSP00000096415
Gene: ENSMUSG00000031600

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Blast:UBCc 29 128 6e-6 BLAST
low complexity region 155 164 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Pfam:Mod_r 235 380 2.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128166
SMART Domains Protein: ENSMUSP00000123070
Gene: ENSMUSG00000039470

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
Pfam:zf-DHHC 122 248 1.8e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132032
AA Change: I74T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122933
Gene: ENSMUSG00000031601
AA Change: I74T

DomainStartEndE-ValueType
Pfam:CAF1 13 240 3.4e-73 PFAM
low complexity region 259 268 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135269
AA Change: I74T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119319
Gene: ENSMUSG00000031601
AA Change: I74T

DomainStartEndE-ValueType
Pfam:CAF1 13 245 7e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149992
AA Change: I74T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117304
Gene: ENSMUSG00000031601
AA Change: I74T

DomainStartEndE-ValueType
Pfam:CAF1 13 240 3.4e-73 PFAM
low complexity region 259 268 N/A INTRINSIC
Meta Mutation Damage Score 0.9135 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to an anti-proliferative protein, B-cell translocation protein 1, which negatively regulates cell proliferation. Binding of the two proteins, which is driven by phosphorylation of the anti-proliferative protein, causes signaling events in cell division that lead to changes in cell proliferation associated with cell-cell contact. The encoded protein downregulates the innate immune response and therefore provides a therapeutic target for enhancing its antimicrobial activity against foreign agents. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null mice display male sterility with oligo-teratozoospermia, impaired sperm motility, unsynchronized spermatid maturation, and Sertoli cell abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A C 3: 121,679,446 K83N unknown Het
Abca13 A T 11: 9,294,649 N2171Y probably damaging Het
Abcc8 G A 7: 46,105,498 T1532I possibly damaging Het
Abtb2 A T 2: 103,702,424 probably null Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Akap9 C A 5: 4,032,696 T1940K probably damaging Het
Armc4 T C 18: 7,222,635 K545E probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc8 A G 7: 16,996,031 T482A unknown Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cenpt G A 8: 105,849,904 Q45* probably null Het
Cnga1 T C 5: 72,605,432 I246M probably benign Het
Cog6 T C 3: 53,002,507 S275G probably benign Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Ergic2 T A 6: 148,188,112 Y249F probably damaging Het
Exoc1 T A 5: 76,542,159 M182K probably damaging Het
Fhdc1 T C 3: 84,444,540 E1126G probably damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gap43 T C 16: 42,292,252 K49E probably damaging Het
Gata4 T A 14: 63,203,742 T276S probably damaging Het
Gca C T 2: 62,689,976 P160L probably benign Het
Ghdc C T 11: 100,768,116 V397I possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gtf3c3 G A 1: 54,417,708 P511L probably benign Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Itgb8 T C 12: 119,202,461 N112D probably benign Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Krtap26-1 T C 16: 88,647,244 Y163C possibly damaging Het
Kyat1 T C 2: 30,191,995 D44G probably benign Het
Mob1a G A 6: 83,338,449 probably null Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Nhsl1 A G 10: 18,527,671 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1496 G A 19: 13,781,324 W235* probably null Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Ptpro G A 6: 137,441,144 probably null Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Ralgps1 T C 2: 33,157,873 K365R probably benign Het
Reep1 A T 6: 71,761,389 I44L probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmem263 T A 10: 85,114,397 probably null Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Tnrc6a A C 7: 123,170,913 N642T probably benign Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Trak1 A G 9: 121,451,863 probably null Het
Trpc4 T C 3: 54,317,627 I799T possibly damaging Het
Ttc7 T C 17: 87,346,542 I549T possibly damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Wrn A G 8: 33,292,718 F728S probably damaging Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfp418 T A 7: 7,182,828 C597S possibly damaging Het
Zfp568 A G 7: 30,017,244 T190A probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Other mutations in Cnot7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Cnot7 APN 8 40507449 splice site probably null
IGL02022:Cnot7 APN 8 40499345 missense probably damaging 1.00
IGL02191:Cnot7 APN 8 40510027 missense probably benign 0.33
R0047:Cnot7 UTSW 8 40495921 splice site probably benign
R0047:Cnot7 UTSW 8 40495921 splice site probably benign
R0166:Cnot7 UTSW 8 40507453 critical splice donor site probably null
R3884:Cnot7 UTSW 8 40510130 start codon destroyed probably null 0.01
R5369:Cnot7 UTSW 8 40494020 missense probably benign 0.12
R5991:Cnot7 UTSW 8 40495655 intron probably null
R6101:Cnot7 UTSW 8 40510037 missense probably benign
R6105:Cnot7 UTSW 8 40510037 missense probably benign
R7548:Cnot7 UTSW 8 40500833 missense probably damaging 1.00
R7639:Cnot7 UTSW 8 40507453 critical splice donor site probably null
R7712:Cnot7 UTSW 8 40494081 missense probably damaging 1.00
Z1088:Cnot7 UTSW 8 40500739 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- CTGCCTCGTAATAATAAGCCTAAAC -3'
(R):5'- TCTGATAGGTAATGCTGTTCATGC -3'

Sequencing Primer
(F):5'- ACATTTCCAGGGACACTG -3'
(R):5'- TAAGCATTGAGTGTGAACATACAG -3'
Posted On2019-06-26