Incidental Mutation 'R7299:Shisa5'
ID566870
Institutional Source Beutler Lab
Gene Symbol Shisa5
Ensembl Gene ENSMUSG00000025647
Gene Nameshisa family member 5
Synonyms2310008D10Rik, Scotin, 6430628I05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7299 (G1)
Quality Score123.008
Status Validated
Chromosome9
Chromosomal Location109038565-109057777 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 109054884 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026737] [ENSMUST00000045011] [ENSMUST00000061973] [ENSMUST00000112053] [ENSMUST00000112059] [ENSMUST00000128062] [ENSMUST00000154184] [ENSMUST00000160217] [ENSMUST00000161521] [ENSMUST00000196954] [ENSMUST00000197099] [ENSMUST00000197483] [ENSMUST00000197689] [ENSMUST00000198281] [ENSMUST00000198295] [ENSMUST00000198376] [ENSMUST00000198708] [ENSMUST00000200515] [ENSMUST00000200629]
Predicted Effect probably benign
Transcript: ENSMUST00000026737
SMART Domains Protein: ENSMUSP00000026737
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Shisa 24 211 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045011
SMART Domains Protein: ENSMUSP00000044831
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
SCOP:d1eq1a_ 96 193 8e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 761 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061973
SMART Domains Protein: ENSMUSP00000050971
Gene: ENSMUSG00000049734

DomainStartEndE-ValueType
EXOIII 13 217 2.45e-13 SMART
low complexity region 248 283 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112053
SMART Domains Protein: ENSMUSP00000107684
Gene: ENSMUSG00000049734

DomainStartEndE-ValueType
EXOIII 13 217 2.45e-13 SMART
low complexity region 248 283 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112059
SMART Domains Protein: ENSMUSP00000107690
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Shisa 26 198 1.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128062
SMART Domains Protein: ENSMUSP00000118499
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
PDB:3MXJ|A 1 150 4e-97 PDB
SCOP:d1fxxa_ 12 146 7e-12 SMART
Blast:EXOIII 13 150 1e-85 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154184
SMART Domains Protein: ENSMUSP00000128901
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 108 1.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160217
SMART Domains Protein: ENSMUSP00000125264
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
SCOP:d1eq1a_ 96 193 3e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 533 550 N/A INTRINSIC
low complexity region 570 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161521
SMART Domains Protein: ENSMUSP00000125615
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
coiled coil region 108 208 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 734 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196954
SMART Domains Protein: ENSMUSP00000143599
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 95 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197099
SMART Domains Protein: ENSMUSP00000143648
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 129 9.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197483
SMART Domains Protein: ENSMUSP00000143613
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 95 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197689
SMART Domains Protein: ENSMUSP00000142874
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 63 4.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198281
SMART Domains Protein: ENSMUSP00000143581
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 16 74 2.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198295
SMART Domains Protein: ENSMUSP00000143721
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 70 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198376
SMART Domains Protein: ENSMUSP00000143374
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 83 5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198708
SMART Domains Protein: ENSMUSP00000142978
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 109 7.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199868
Predicted Effect probably benign
Transcript: ENSMUST00000200515
SMART Domains Protein: ENSMUSP00000142835
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 11 147 4.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200629
SMART Domains Protein: ENSMUSP00000142404
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 72 1.9e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the shisa family. The encoded protein is localized to the endoplasmic reticulum, and together with p53 induces apoptosis in a caspase-dependent manner. Alternative splicing results in multiple transcript variants. Related pseudogenes of this gene are found on chromosome X. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and exhibit no apparent phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A C 3: 121,679,446 K83N unknown Het
Abca13 A T 11: 9,294,649 N2171Y probably damaging Het
Abcc8 G A 7: 46,105,498 T1532I possibly damaging Het
Abtb2 A T 2: 103,702,424 probably null Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Akap9 C A 5: 4,032,696 T1940K probably damaging Het
Armc4 T C 18: 7,222,635 K545E probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc8 A G 7: 16,996,031 T482A unknown Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cenpt G A 8: 105,849,904 Q45* probably null Het
Cnga1 T C 5: 72,605,432 I246M probably benign Het
Cnot7 A G 8: 40,507,545 I74T probably damaging Het
Cog6 T C 3: 53,002,507 S275G probably benign Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Ergic2 T A 6: 148,188,112 Y249F probably damaging Het
Exoc1 T A 5: 76,542,159 M182K probably damaging Het
Fhdc1 T C 3: 84,444,540 E1126G probably damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gap43 T C 16: 42,292,252 K49E probably damaging Het
Gata4 T A 14: 63,203,742 T276S probably damaging Het
Gca C T 2: 62,689,976 P160L probably benign Het
Ghdc C T 11: 100,768,116 V397I possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gtf3c3 G A 1: 54,417,708 P511L probably benign Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Itgb8 T C 12: 119,202,461 N112D probably benign Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Krtap26-1 T C 16: 88,647,244 Y163C possibly damaging Het
Kyat1 T C 2: 30,191,995 D44G probably benign Het
Mob1a G A 6: 83,338,449 probably null Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Nhsl1 A G 10: 18,527,671 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1496 G A 19: 13,781,324 W235* probably null Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Ptpro G A 6: 137,441,144 probably null Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Ralgps1 T C 2: 33,157,873 K365R probably benign Het
Reep1 A T 6: 71,761,389 I44L probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmem263 T A 10: 85,114,397 probably null Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Tnrc6a A C 7: 123,170,913 N642T probably benign Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Trak1 A G 9: 121,451,863 probably null Het
Trpc4 T C 3: 54,317,627 I799T possibly damaging Het
Ttc7 T C 17: 87,346,542 I549T possibly damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Wrn A G 8: 33,292,718 F728S probably damaging Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfp418 T A 7: 7,182,828 C597S possibly damaging Het
Zfp568 A G 7: 30,017,244 T190A probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Other mutations in Shisa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02735:Shisa5 APN 9 109056012 missense probably damaging 1.00
IGL02989:Shisa5 APN 9 109055994 missense probably damaging 1.00
IGL03169:Shisa5 APN 9 109056492 missense probably damaging 1.00
R1809:Shisa5 UTSW 9 109040930 missense probably damaging 0.99
R1813:Shisa5 UTSW 9 109056040 missense probably damaging 0.99
R1896:Shisa5 UTSW 9 109056040 missense probably damaging 0.99
R2516:Shisa5 UTSW 9 109056507 critical splice donor site probably null
R4706:Shisa5 UTSW 9 109056060 missense probably null 0.99
R5800:Shisa5 UTSW 9 109056094 critical splice donor site probably null
R5935:Shisa5 UTSW 9 109056683 missense possibly damaging 0.68
R7301:Shisa5 UTSW 9 109054884 intron probably benign
Predicted Primers PCR Primer
(F):5'- TAGCCTTCTTTTAGAGGCCTGG -3'
(R):5'- ACATTCGCATGGTCCGTTG -3'

Sequencing Primer
(F):5'- CTTTTAGAGGCCTGGGAACAC -3'
(R):5'- CATGGTCCGTTGCATGCAG -3'
Posted On2019-06-26