Incidental Mutation 'R7299:Zfp280b'
ID566875
Institutional Source Beutler Lab
Gene Symbol Zfp280b
Ensembl Gene ENSMUSG00000049764
Gene Namezinc finger protein 280B
SynonymsSuhw2, D10Jhu82e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R7299 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location76032650-76043234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 76038703 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 139 (Q139E)
Ref Sequence ENSEMBL: ENSMUSP00000056340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061617] [ENSMUST00000218627]
Predicted Effect probably damaging
Transcript: ENSMUST00000061617
AA Change: Q139E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056340
Gene: ENSMUSG00000049764
AA Change: Q139E

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 29 37 N/A INTRINSIC
Pfam:DUF4195 53 227 1.3e-38 PFAM
ZnF_C2H2 297 318 3.65e1 SMART
ZnF_C2H2 334 357 9.46e0 SMART
ZnF_C2H2 364 387 8.22e-2 SMART
ZnF_C2H2 394 417 4.23e0 SMART
ZnF_C2H2 423 445 1.72e1 SMART
ZnF_C2H2 451 474 2.12e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that upregulates expression of MDM2, which negatively regulates p53 expression. This gene is highly expressed in prostate cancer cells, which leads to a reduction in p53 levels and an increase in growth of the cancer cells. Several transcript variants have been found for this gene, but only one of them is protein-coding. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A C 3: 121,679,446 K83N unknown Het
Abca13 A T 11: 9,294,649 N2171Y probably damaging Het
Abcc8 G A 7: 46,105,498 T1532I possibly damaging Het
Abtb2 A T 2: 103,702,424 probably null Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Akap9 C A 5: 4,032,696 T1940K probably damaging Het
Armc4 T C 18: 7,222,635 K545E probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc8 A G 7: 16,996,031 T482A unknown Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cenpt G A 8: 105,849,904 Q45* probably null Het
Cnga1 T C 5: 72,605,432 I246M probably benign Het
Cnot7 A G 8: 40,507,545 I74T probably damaging Het
Cog6 T C 3: 53,002,507 S275G probably benign Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Ergic2 T A 6: 148,188,112 Y249F probably damaging Het
Exoc1 T A 5: 76,542,159 M182K probably damaging Het
Fhdc1 T C 3: 84,444,540 E1126G probably damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gap43 T C 16: 42,292,252 K49E probably damaging Het
Gata4 T A 14: 63,203,742 T276S probably damaging Het
Gca C T 2: 62,689,976 P160L probably benign Het
Ghdc C T 11: 100,768,116 V397I possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gtf3c3 G A 1: 54,417,708 P511L probably benign Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Itgb8 T C 12: 119,202,461 N112D probably benign Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Krtap26-1 T C 16: 88,647,244 Y163C possibly damaging Het
Kyat1 T C 2: 30,191,995 D44G probably benign Het
Mob1a G A 6: 83,338,449 probably null Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Nhsl1 A G 10: 18,527,671 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1496 G A 19: 13,781,324 W235* probably null Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Ptpro G A 6: 137,441,144 probably null Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Ralgps1 T C 2: 33,157,873 K365R probably benign Het
Reep1 A T 6: 71,761,389 I44L probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmem263 T A 10: 85,114,397 probably null Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Tnrc6a A C 7: 123,170,913 N642T probably benign Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Trak1 A G 9: 121,451,863 probably null Het
Trpc4 T C 3: 54,317,627 I799T possibly damaging Het
Ttc7 T C 17: 87,346,542 I549T possibly damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Wrn A G 8: 33,292,718 F728S probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfp418 T A 7: 7,182,828 C597S possibly damaging Het
Zfp568 A G 7: 30,017,244 T190A probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Other mutations in Zfp280b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Zfp280b APN 10 76039663 missense probably damaging 0.99
IGL02016:Zfp280b APN 10 76039111 missense possibly damaging 0.68
IGL02245:Zfp280b APN 10 76039363 missense probably benign
IGL03233:Zfp280b APN 10 76039769 missense probably damaging 1.00
R0864:Zfp280b UTSW 10 76038305 missense probably benign 0.00
R1501:Zfp280b UTSW 10 76039769 missense probably damaging 1.00
R1643:Zfp280b UTSW 10 76039610 missense probably damaging 1.00
R2004:Zfp280b UTSW 10 76038536 missense probably benign 0.00
R2024:Zfp280b UTSW 10 76038494 missense probably damaging 1.00
R2025:Zfp280b UTSW 10 76038494 missense probably damaging 1.00
R2027:Zfp280b UTSW 10 76038494 missense probably damaging 1.00
R2064:Zfp280b UTSW 10 76039183 missense probably damaging 1.00
R3729:Zfp280b UTSW 10 76039102 missense probably benign 0.33
R4634:Zfp280b UTSW 10 76038829 missense probably benign 0.00
R4812:Zfp280b UTSW 10 76039090 missense probably benign 0.24
R4968:Zfp280b UTSW 10 76039354 missense probably damaging 1.00
R5007:Zfp280b UTSW 10 76039214 missense probably damaging 1.00
R5123:Zfp280b UTSW 10 76039349 missense probably benign 0.02
R5503:Zfp280b UTSW 10 76039462 unclassified probably null
R5552:Zfp280b UTSW 10 76039663 nonsense probably null
R6954:Zfp280b UTSW 10 76039688 missense probably benign 0.36
R7301:Zfp280b UTSW 10 76038703 missense probably damaging 0.98
R7485:Zfp280b UTSW 10 76039241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGGTGACTTCAGCTTCC -3'
(R):5'- CAATACTATGGTCAGGCCTCTG -3'

Sequencing Primer
(F):5'- TTTGAACAGAGTCACCCCAGGTTC -3'
(R):5'- CCTCTGTGGATTTATGGAAAAATGGC -3'
Posted On2019-06-26