Incidental Mutation 'R7299:Abca13'
ID 566878
Institutional Source Beutler Lab
Gene Symbol Abca13
Ensembl Gene ENSMUSG00000004668
Gene Name ATP-binding cassette, sub-family A member 13
Synonyms A930002G16Rik
MMRRC Submission 045403-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7299 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 9141942-9634259 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 9244649 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 2171 (N2171Y)
Ref Sequence ENSEMBL: ENSMUSP00000040465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042740]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000042740
AA Change: N2171Y

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040465
Gene: ENSMUSG00000004668
AA Change: N2171Y

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 358 379 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 1382 1393 N/A INTRINSIC
low complexity region 1721 1737 N/A INTRINSIC
low complexity region 1859 1872 N/A INTRINSIC
Pfam:ABC2_membrane_3 3288 3740 4.7e-21 PFAM
low complexity region 3796 3809 N/A INTRINSIC
AAA 3835 4019 8.08e-12 SMART
transmembrane domain 4206 4228 N/A INTRINSIC
Pfam:ABC2_membrane_3 4317 4646 1.6e-33 PFAM
AAA 4721 4909 8.86e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.[provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(3) : Targeted(3

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A C 3: 121,473,095 (GRCm39) K83N unknown Het
Abcc8 G A 7: 45,754,922 (GRCm39) T1532I possibly damaging Het
Abtb2 A T 2: 103,532,769 (GRCm39) probably null Het
Actmap G A 7: 26,900,548 (GRCm39) A176T probably damaging Het
Agk A T 6: 40,306,451 (GRCm39) T7S possibly damaging Het
Akap9 C A 5: 4,082,696 (GRCm39) T1940K probably damaging Het
Ccdc8 A G 7: 16,729,956 (GRCm39) T482A unknown Het
Cd2ap G A 17: 43,140,904 (GRCm39) R212* probably null Het
Cenpt G A 8: 106,576,536 (GRCm39) Q45* probably null Het
Cnga1 T C 5: 72,762,775 (GRCm39) I246M probably benign Het
Cnot7 A G 8: 40,960,586 (GRCm39) I74T probably damaging Het
Cog6 T C 3: 52,909,928 (GRCm39) S275G probably benign Het
Csmd2 C A 4: 128,422,055 (GRCm39) D2797E Het
Ddx24 A G 12: 103,385,709 (GRCm39) M298T possibly damaging Het
Eif2b3 T A 4: 116,910,019 (GRCm39) S185T probably benign Het
Ergic2 T A 6: 148,089,610 (GRCm39) Y249F probably damaging Het
Exoc1 T A 5: 76,690,006 (GRCm39) M182K probably damaging Het
Fhdc1 T C 3: 84,351,847 (GRCm39) E1126G probably damaging Het
Gabrr2 T A 4: 33,095,284 (GRCm39) M391K probably benign Het
Gap43 T C 16: 42,112,615 (GRCm39) K49E probably damaging Het
Gata4 T A 14: 63,441,191 (GRCm39) T276S probably damaging Het
Gca C T 2: 62,520,320 (GRCm39) P160L probably benign Het
Ghdc C T 11: 100,658,942 (GRCm39) V397I possibly damaging Het
Gm3409 T A 5: 146,476,357 (GRCm39) D169E probably benign Het
Gtf3c3 G A 1: 54,456,867 (GRCm39) P511L probably benign Het
Hal T C 10: 93,328,423 (GRCm39) V233A probably benign Het
Ighv1-4 T C 12: 114,450,908 (GRCm39) I67V probably benign Het
Itgb8 T C 12: 119,166,196 (GRCm39) N112D probably benign Het
Klhl38 G A 15: 58,186,376 (GRCm39) R118W probably damaging Het
Krtap26-1 T C 16: 88,444,132 (GRCm39) Y163C possibly damaging Het
Kyat1 T C 2: 30,082,007 (GRCm39) D44G probably benign Het
Mob1a G A 6: 83,315,431 (GRCm39) probably null Het
Mst1r G T 9: 107,791,989 (GRCm39) A842S possibly damaging Het
Nhsl1 A G 10: 18,403,419 (GRCm39) probably null Het
Nos1 A T 5: 118,005,970 (GRCm39) D230V possibly damaging Het
Nppb T C 4: 148,070,780 (GRCm39) S52P probably benign Het
Odad2 T C 18: 7,222,635 (GRCm39) K545E probably damaging Het
Olfml3 T C 3: 103,643,176 (GRCm39) K402E probably damaging Het
Or1s2 G A 19: 13,758,688 (GRCm39) W235* probably null Het
Pcdha3 G A 18: 37,079,977 (GRCm39) E240K possibly damaging Het
Podxl G T 6: 31,501,371 (GRCm39) P395T probably damaging Het
Prr5l T A 2: 101,547,631 (GRCm39) D298V probably damaging Het
Ptpro G A 6: 137,418,142 (GRCm39) probably null Het
Rad9b A G 5: 122,490,677 (GRCm39) V13A possibly damaging Het
Ralgps1 T C 2: 33,047,885 (GRCm39) K365R probably benign Het
Reep1 A T 6: 71,738,373 (GRCm39) I44L probably benign Het
Ripor2 T C 13: 24,908,984 (GRCm39) I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,812,016 (GRCm39) Y338H probably damaging Het
Shisa5 G T 9: 108,883,952 (GRCm39) probably benign Het
Snx24 G T 18: 53,473,244 (GRCm39) V63F probably damaging Het
Svep1 G A 4: 58,046,587 (GRCm39) Q3515* probably null Het
Tfap2a T C 13: 40,874,784 (GRCm39) K276E probably damaging Het
Tmem158 C A 9: 123,089,366 (GRCm39) S82I probably damaging Het
Tmem263 T A 10: 84,950,261 (GRCm39) probably null Het
Tmtc3 G T 10: 100,283,336 (GRCm39) H740N not run Het
Tnrc6a A C 7: 122,770,136 (GRCm39) N642T probably benign Het
Top3a A T 11: 60,638,974 (GRCm39) F559I probably damaging Het
Trak1 A G 9: 121,280,929 (GRCm39) probably null Het
Trpc4 T C 3: 54,225,048 (GRCm39) I799T possibly damaging Het
Ttc7 T C 17: 87,653,970 (GRCm39) I549T possibly damaging Het
Tysnd1 C A 10: 61,532,328 (GRCm39) P327T possibly damaging Het
Ulk4 T A 9: 120,974,125 (GRCm39) D969V probably benign Het
Vcan T A 13: 89,853,385 (GRCm39) Y525F probably benign Het
Vmn1r204 G A 13: 22,740,975 (GRCm39) S202N probably damaging Het
Vmn2r107 A G 17: 20,565,878 (GRCm39) I64M probably benign Het
Wrn A G 8: 33,782,746 (GRCm39) F728S probably damaging Het
Zfp280b C G 10: 75,874,537 (GRCm39) Q139E probably damaging Het
Zfp322a C A 13: 23,541,313 (GRCm39) G143V probably damaging Het
Zfp322a C T 13: 23,541,314 (GRCm39) G143S probably benign Het
Zfp418 T A 7: 7,185,827 (GRCm39) C597S possibly damaging Het
Zfp568 A G 7: 29,716,669 (GRCm39) T190A probably benign Het
Zfyve26 A T 12: 79,329,758 (GRCm39) V476D probably benign Het
Other mutations in Abca13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Abca13 APN 11 9,247,443 (GRCm39) missense probably benign 0.24
IGL00481:Abca13 APN 11 9,240,969 (GRCm39) missense probably damaging 0.99
IGL00707:Abca13 APN 11 9,241,586 (GRCm39) missense probably damaging 0.99
IGL00755:Abca13 APN 11 9,492,102 (GRCm39) missense possibly damaging 0.87
IGL00771:Abca13 APN 11 9,240,870 (GRCm39) missense probably damaging 1.00
IGL00802:Abca13 APN 11 9,247,717 (GRCm39) missense probably damaging 0.96
IGL00807:Abca13 APN 11 9,328,285 (GRCm39) missense probably benign 0.10
IGL00977:Abca13 APN 11 9,349,284 (GRCm39) missense probably damaging 1.00
IGL01064:Abca13 APN 11 9,433,855 (GRCm39) missense probably benign 0.01
IGL01100:Abca13 APN 11 9,224,673 (GRCm39) splice site probably null
IGL01290:Abca13 APN 11 9,206,232 (GRCm39) missense probably damaging 1.00
IGL01299:Abca13 APN 11 9,248,743 (GRCm39) missense probably benign 0.22
IGL01302:Abca13 APN 11 9,349,470 (GRCm39) splice site probably benign
IGL01307:Abca13 APN 11 9,247,159 (GRCm39) missense possibly damaging 0.86
IGL01349:Abca13 APN 11 9,242,076 (GRCm39) missense probably benign 0.05
IGL01351:Abca13 APN 11 9,217,565 (GRCm39) missense probably benign 0.28
IGL01446:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01453:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01461:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01476:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01506:Abca13 APN 11 9,247,447 (GRCm39) missense probably benign 0.36
IGL01527:Abca13 APN 11 9,240,788 (GRCm39) missense possibly damaging 0.49
IGL01559:Abca13 APN 11 9,259,020 (GRCm39) missense possibly damaging 0.82
IGL01580:Abca13 APN 11 9,243,527 (GRCm39) missense probably benign 0.00
IGL01679:Abca13 APN 11 9,248,071 (GRCm39) missense probably benign 0.07
IGL01731:Abca13 APN 11 9,199,749 (GRCm39) splice site probably benign
IGL01762:Abca13 APN 11 9,265,423 (GRCm39) missense probably benign 0.18
IGL01781:Abca13 APN 11 9,349,280 (GRCm39) missense probably damaging 1.00
IGL01802:Abca13 APN 11 9,242,438 (GRCm39) missense probably benign 0.00
IGL01809:Abca13 APN 11 9,240,339 (GRCm39) missense probably damaging 0.96
IGL01906:Abca13 APN 11 9,166,225 (GRCm39) missense probably damaging 1.00
IGL01928:Abca13 APN 11 9,633,342 (GRCm39) missense probably benign 0.13
IGL01940:Abca13 APN 11 9,517,661 (GRCm39) splice site probably benign
IGL01993:Abca13 APN 11 9,208,452 (GRCm39) unclassified probably benign
IGL02039:Abca13 APN 11 9,247,193 (GRCm39) nonsense probably null
IGL02159:Abca13 APN 11 9,264,545 (GRCm39) missense probably benign 0.00
IGL02202:Abca13 APN 11 9,238,529 (GRCm39) missense possibly damaging 0.55
IGL02268:Abca13 APN 11 9,240,626 (GRCm39) missense probably benign 0.00
IGL02332:Abca13 APN 11 9,241,482 (GRCm39) missense probably damaging 0.98
IGL02380:Abca13 APN 11 9,241,599 (GRCm39) missense possibly damaging 0.73
IGL02466:Abca13 APN 11 9,247,527 (GRCm39) missense probably benign 0.00
IGL02505:Abca13 APN 11 9,531,498 (GRCm39) missense probably damaging 1.00
IGL02507:Abca13 APN 11 9,349,388 (GRCm39) missense probably damaging 1.00
IGL02558:Abca13 APN 11 9,349,387 (GRCm39) missense probably damaging 1.00
IGL02581:Abca13 APN 11 9,349,132 (GRCm39) splice site probably benign
IGL02586:Abca13 APN 11 9,243,983 (GRCm39) missense possibly damaging 0.56
IGL02598:Abca13 APN 11 9,381,898 (GRCm39) missense probably damaging 1.00
IGL02747:Abca13 APN 11 9,323,282 (GRCm39) nonsense probably null
IGL02893:Abca13 APN 11 9,240,543 (GRCm39) missense probably damaging 0.96
IGL02930:Abca13 APN 11 9,328,226 (GRCm39) missense possibly damaging 0.86
IGL02967:Abca13 APN 11 9,328,291 (GRCm39) missense probably damaging 0.99
IGL02983:Abca13 APN 11 9,240,663 (GRCm39) missense probably benign 0.40
IGL02999:Abca13 APN 11 9,531,757 (GRCm39) splice site probably benign
IGL03100:Abca13 APN 11 9,208,527 (GRCm39) missense probably benign 0.25
IGL03114:Abca13 APN 11 9,478,999 (GRCm39) missense probably benign 0.06
IGL03230:Abca13 APN 11 9,244,313 (GRCm39) missense probably benign 0.02
IGL03329:Abca13 APN 11 9,248,047 (GRCm39) missense probably benign 0.08
IGL03380:Abca13 APN 11 9,248,574 (GRCm39) missense probably benign 0.10
IGL02835:Abca13 UTSW 11 9,401,515 (GRCm39) missense probably damaging 1.00
PIT4366001:Abca13 UTSW 11 9,244,962 (GRCm39) missense probably benign
PIT4458001:Abca13 UTSW 11 9,248,304 (GRCm39) missense probably benign 0.05
R0017:Abca13 UTSW 11 9,242,775 (GRCm39) missense probably damaging 0.99
R0079:Abca13 UTSW 11 9,243,493 (GRCm39) missense probably benign 0.00
R0089:Abca13 UTSW 11 9,242,886 (GRCm39) missense possibly damaging 0.76
R0103:Abca13 UTSW 11 9,223,951 (GRCm39) missense probably damaging 1.00
R0103:Abca13 UTSW 11 9,223,951 (GRCm39) missense probably damaging 1.00
R0113:Abca13 UTSW 11 9,242,114 (GRCm39) missense possibly damaging 0.54
R0119:Abca13 UTSW 11 9,248,076 (GRCm39) missense probably benign 0.03
R0152:Abca13 UTSW 11 9,531,724 (GRCm39) missense probably damaging 0.98
R0255:Abca13 UTSW 11 9,531,545 (GRCm39) missense probably damaging 1.00
R0277:Abca13 UTSW 11 9,244,701 (GRCm39) missense probably benign 0.25
R0278:Abca13 UTSW 11 9,328,215 (GRCm39) missense probably damaging 1.00
R0294:Abca13 UTSW 11 9,219,122 (GRCm39) splice site probably null
R0299:Abca13 UTSW 11 9,248,076 (GRCm39) missense probably benign 0.03
R0310:Abca13 UTSW 11 9,243,810 (GRCm39) missense probably benign 0.36
R0317:Abca13 UTSW 11 9,243,459 (GRCm39) missense probably damaging 1.00
R0323:Abca13 UTSW 11 9,244,701 (GRCm39) missense probably benign 0.25
R0324:Abca13 UTSW 11 9,247,669 (GRCm39) missense possibly damaging 0.76
R0329:Abca13 UTSW 11 9,349,430 (GRCm39) missense probably damaging 0.97
R0336:Abca13 UTSW 11 9,248,481 (GRCm39) missense probably benign 0.04
R0346:Abca13 UTSW 11 9,516,278 (GRCm39) missense probably damaging 0.99
R0380:Abca13 UTSW 11 9,538,500 (GRCm39) splice site probably null
R0382:Abca13 UTSW 11 9,586,650 (GRCm39) splice site probably benign
R0482:Abca13 UTSW 11 9,278,207 (GRCm39) missense possibly damaging 0.88
R0487:Abca13 UTSW 11 9,281,687 (GRCm39) missense probably benign 0.07
R0491:Abca13 UTSW 11 9,248,235 (GRCm39) missense probably benign 0.02
R0496:Abca13 UTSW 11 9,241,701 (GRCm39) missense probably benign 0.01
R0505:Abca13 UTSW 11 9,241,058 (GRCm39) missense probably benign 0.00
R0511:Abca13 UTSW 11 9,244,559 (GRCm39) missense probably benign
R0525:Abca13 UTSW 11 9,243,371 (GRCm39) missense probably damaging 1.00
R0538:Abca13 UTSW 11 9,217,622 (GRCm39) critical splice donor site probably null
R0615:Abca13 UTSW 11 9,206,197 (GRCm39) missense probably damaging 0.96
R0634:Abca13 UTSW 11 9,264,491 (GRCm39) missense possibly damaging 0.59
R0699:Abca13 UTSW 11 9,538,508 (GRCm39) splice site probably benign
R0848:Abca13 UTSW 11 9,632,011 (GRCm39) nonsense probably null
R0883:Abca13 UTSW 11 9,241,238 (GRCm39) nonsense probably null
R0892:Abca13 UTSW 11 9,248,305 (GRCm39) missense probably benign 0.00
R0904:Abca13 UTSW 11 9,248,740 (GRCm39) missense probably benign 0.22
R0968:Abca13 UTSW 11 9,248,016 (GRCm39) missense probably benign 0.00
R1187:Abca13 UTSW 11 9,478,981 (GRCm39) missense probably benign 0.00
R1299:Abca13 UTSW 11 9,244,821 (GRCm39) missense possibly damaging 0.94
R1323:Abca13 UTSW 11 9,240,937 (GRCm39) missense possibly damaging 0.86
R1323:Abca13 UTSW 11 9,240,937 (GRCm39) missense possibly damaging 0.86
R1368:Abca13 UTSW 11 9,241,836 (GRCm39) missense probably benign
R1387:Abca13 UTSW 11 9,632,085 (GRCm39) nonsense probably null
R1436:Abca13 UTSW 11 9,242,646 (GRCm39) missense probably damaging 0.99
R1449:Abca13 UTSW 11 9,248,580 (GRCm39) missense probably damaging 1.00
R1450:Abca13 UTSW 11 9,380,531 (GRCm39) splice site probably benign
R1462:Abca13 UTSW 11 9,433,924 (GRCm39) splice site probably benign
R1465:Abca13 UTSW 11 9,349,303 (GRCm39) missense probably damaging 1.00
R1465:Abca13 UTSW 11 9,349,303 (GRCm39) missense probably damaging 1.00
R1466:Abca13 UTSW 11 9,520,536 (GRCm39) splice site probably benign
R1494:Abca13 UTSW 11 9,416,429 (GRCm39) nonsense probably null
R1559:Abca13 UTSW 11 9,349,180 (GRCm39) missense probably null 1.00
R1564:Abca13 UTSW 11 9,384,316 (GRCm39) nonsense probably null
R1698:Abca13 UTSW 11 9,264,507 (GRCm39) missense probably benign 0.13
R1728:Abca13 UTSW 11 9,199,680 (GRCm39) missense probably benign 0.02
R1734:Abca13 UTSW 11 9,535,460 (GRCm39) missense probably benign 0.03
R1781:Abca13 UTSW 11 9,219,194 (GRCm39) missense probably damaging 1.00
R1782:Abca13 UTSW 11 9,247,971 (GRCm39) missense probably benign 0.36
R1807:Abca13 UTSW 11 9,241,755 (GRCm39) missense probably damaging 0.98
R1830:Abca13 UTSW 11 9,240,350 (GRCm39) missense probably benign 0.04
R1869:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1870:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1871:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1903:Abca13 UTSW 11 9,416,411 (GRCm39) missense probably benign 0.13
R1916:Abca13 UTSW 11 9,484,456 (GRCm39) missense probably damaging 1.00
R1936:Abca13 UTSW 11 9,243,595 (GRCm39) missense probably benign 0.13
R1976:Abca13 UTSW 11 9,347,815 (GRCm39) missense probably damaging 1.00
R2001:Abca13 UTSW 11 9,223,967 (GRCm39) missense probably benign 0.01
R2007:Abca13 UTSW 11 9,141,987 (GRCm39) missense probably benign 0.19
R2016:Abca13 UTSW 11 9,240,619 (GRCm39) missense probably damaging 1.00
R2017:Abca13 UTSW 11 9,240,619 (GRCm39) missense probably damaging 1.00
R2034:Abca13 UTSW 11 9,242,628 (GRCm39) missense possibly damaging 0.83
R2051:Abca13 UTSW 11 9,278,098 (GRCm39) missense probably benign 0.04
R2075:Abca13 UTSW 11 9,472,382 (GRCm39) missense probably damaging 1.00
R2118:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2120:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2124:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2148:Abca13 UTSW 11 9,565,764 (GRCm39) missense probably damaging 1.00
R2149:Abca13 UTSW 11 9,217,508 (GRCm39) missense possibly damaging 0.68
R2157:Abca13 UTSW 11 9,527,170 (GRCm39) missense probably damaging 0.97
R2167:Abca13 UTSW 11 9,238,532 (GRCm39) missense probably benign 0.19
R2261:Abca13 UTSW 11 9,242,288 (GRCm39) missense probably benign
R2263:Abca13 UTSW 11 9,224,702 (GRCm39) missense probably benign 0.04
R2281:Abca13 UTSW 11 9,278,136 (GRCm39) missense probably damaging 0.98
R2340:Abca13 UTSW 11 9,349,165 (GRCm39) missense probably damaging 0.99
R2357:Abca13 UTSW 11 9,247,336 (GRCm39) missense probably damaging 1.00
R2370:Abca13 UTSW 11 9,206,185 (GRCm39) missense possibly damaging 0.85
R2384:Abca13 UTSW 11 9,217,450 (GRCm39) splice site probably benign
R2393:Abca13 UTSW 11 9,225,057 (GRCm39) nonsense probably null
R2432:Abca13 UTSW 11 9,401,333 (GRCm39) splice site probably benign
R2446:Abca13 UTSW 11 9,225,101 (GRCm39) missense probably benign
R2568:Abca13 UTSW 11 9,283,310 (GRCm39) missense probably benign 0.40
R2847:Abca13 UTSW 11 9,244,584 (GRCm39) missense possibly damaging 0.59
R2860:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2861:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2862:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2877:Abca13 UTSW 11 9,241,889 (GRCm39) missense possibly damaging 0.91
R2878:Abca13 UTSW 11 9,241,889 (GRCm39) missense possibly damaging 0.91
R3748:Abca13 UTSW 11 9,266,119 (GRCm39) splice site probably benign
R3789:Abca13 UTSW 11 9,460,668 (GRCm39) missense probably damaging 0.97
R3933:Abca13 UTSW 11 9,304,856 (GRCm39) missense probably damaging 1.00
R3981:Abca13 UTSW 11 9,482,407 (GRCm39) missense probably benign
R4002:Abca13 UTSW 11 9,535,415 (GRCm39) missense probably benign 0.00
R4010:Abca13 UTSW 11 9,572,013 (GRCm39) splice site probably benign
R4011:Abca13 UTSW 11 9,572,013 (GRCm39) splice site probably benign
R4127:Abca13 UTSW 11 9,141,973 (GRCm39) missense probably benign 0.00
R4214:Abca13 UTSW 11 9,243,877 (GRCm39) missense probably damaging 0.96
R4236:Abca13 UTSW 11 9,206,205 (GRCm39) missense probably damaging 1.00
R4237:Abca13 UTSW 11 9,384,188 (GRCm39) missense probably benign 0.01
R4359:Abca13 UTSW 11 9,247,629 (GRCm39) missense probably benign 0.02
R4378:Abca13 UTSW 11 9,243,644 (GRCm39) missense probably benign 0.00
R4389:Abca13 UTSW 11 9,247,878 (GRCm39) missense probably damaging 0.98
R4392:Abca13 UTSW 11 9,259,034 (GRCm39) missense possibly damaging 0.94
R4623:Abca13 UTSW 11 9,259,130 (GRCm39) missense probably damaging 1.00
R4684:Abca13 UTSW 11 9,384,193 (GRCm39) nonsense probably null
R4691:Abca13 UTSW 11 9,384,195 (GRCm39) missense probably damaging 1.00
R4700:Abca13 UTSW 11 9,242,306 (GRCm39) missense possibly damaging 0.59
R4701:Abca13 UTSW 11 9,242,306 (GRCm39) missense possibly damaging 0.59
R4704:Abca13 UTSW 11 9,226,990 (GRCm39) missense possibly damaging 0.94
R4751:Abca13 UTSW 11 9,227,973 (GRCm39) critical splice donor site probably null
R4772:Abca13 UTSW 11 9,265,339 (GRCm39) splice site probably null
R4782:Abca13 UTSW 11 9,278,096 (GRCm39) missense probably damaging 0.96
R4801:Abca13 UTSW 11 9,472,341 (GRCm39) missense possibly damaging 0.94
R4802:Abca13 UTSW 11 9,472,341 (GRCm39) missense possibly damaging 0.94
R4819:Abca13 UTSW 11 9,240,421 (GRCm39) missense possibly damaging 0.88
R4831:Abca13 UTSW 11 9,492,077 (GRCm39) nonsense probably null
R4851:Abca13 UTSW 11 9,433,890 (GRCm39) missense probably benign 0.02
R4857:Abca13 UTSW 11 9,244,143 (GRCm39) missense probably benign 0.22
R4869:Abca13 UTSW 11 9,265,434 (GRCm39) splice site probably null
R4982:Abca13 UTSW 11 9,242,348 (GRCm39) missense possibly damaging 0.58
R5031:Abca13 UTSW 11 9,247,678 (GRCm39) missense probably damaging 0.99
R5044:Abca13 UTSW 11 9,323,323 (GRCm39) missense possibly damaging 0.80
R5092:Abca13 UTSW 11 9,208,535 (GRCm39) missense probably damaging 1.00
R5155:Abca13 UTSW 11 9,482,447 (GRCm39) missense probably damaging 0.98
R5173:Abca13 UTSW 11 9,632,032 (GRCm39) frame shift probably null
R5180:Abca13 UTSW 11 9,416,510 (GRCm39) missense probably benign 0.01
R5244:Abca13 UTSW 11 9,225,081 (GRCm39) missense probably benign 0.28
R5257:Abca13 UTSW 11 9,199,684 (GRCm39) missense possibly damaging 0.94
R5258:Abca13 UTSW 11 9,199,684 (GRCm39) missense possibly damaging 0.94
R5299:Abca13 UTSW 11 9,381,861 (GRCm39) missense probably damaging 1.00
R5363:Abca13 UTSW 11 9,227,035 (GRCm39) missense possibly damaging 0.75
R5365:Abca13 UTSW 11 9,578,629 (GRCm39) missense probably damaging 1.00
R5419:Abca13 UTSW 11 9,143,533 (GRCm39) critical splice donor site probably null
R5426:Abca13 UTSW 11 9,240,722 (GRCm39) missense probably damaging 1.00
R5468:Abca13 UTSW 11 9,244,062 (GRCm39) missense probably damaging 1.00
R5477:Abca13 UTSW 11 9,251,298 (GRCm39) missense possibly damaging 0.49
R5541:Abca13 UTSW 11 9,241,545 (GRCm39) missense probably benign 0.00
R5553:Abca13 UTSW 11 9,278,158 (GRCm39) missense probably damaging 1.00
R5556:Abca13 UTSW 11 9,208,546 (GRCm39) missense possibly damaging 0.91
R5566:Abca13 UTSW 11 9,244,615 (GRCm39) nonsense probably null
R5582:Abca13 UTSW 11 9,586,639 (GRCm39) splice site probably null
R5604:Abca13 UTSW 11 9,516,279 (GRCm39) missense probably damaging 0.97
R5609:Abca13 UTSW 11 9,353,874 (GRCm39) missense probably benign 0.01
R5617:Abca13 UTSW 11 9,227,891 (GRCm39) missense probably benign 0.00
R5693:Abca13 UTSW 11 9,266,233 (GRCm39) missense probably benign 0.29
R5707:Abca13 UTSW 11 9,460,620 (GRCm39) missense probably damaging 1.00
R5725:Abca13 UTSW 11 9,527,181 (GRCm39) missense probably benign 0.00
R5728:Abca13 UTSW 11 9,520,576 (GRCm39) missense probably damaging 1.00
R5738:Abca13 UTSW 11 9,571,917 (GRCm39) missense probably damaging 1.00
R5758:Abca13 UTSW 11 9,264,536 (GRCm39) missense probably damaging 0.97
R5762:Abca13 UTSW 11 9,531,665 (GRCm39) missense probably damaging 1.00
R5771:Abca13 UTSW 11 9,241,411 (GRCm39) missense probably damaging 1.00
R5809:Abca13 UTSW 11 9,243,692 (GRCm39) missense probably damaging 1.00
R5826:Abca13 UTSW 11 9,632,056 (GRCm39) missense probably damaging 0.99
R5831:Abca13 UTSW 11 9,517,777 (GRCm39) nonsense probably null
R5834:Abca13 UTSW 11 9,227,974 (GRCm39) critical splice donor site probably null
R5902:Abca13 UTSW 11 9,247,177 (GRCm39) missense probably damaging 1.00
R5933:Abca13 UTSW 11 9,199,658 (GRCm39) missense possibly damaging 0.63
R5945:Abca13 UTSW 11 9,243,398 (GRCm39) missense probably benign 0.04
R5969:Abca13 UTSW 11 9,242,214 (GRCm39) nonsense probably null
R5985:Abca13 UTSW 11 9,241,628 (GRCm39) missense probably benign 0.02
R5998:Abca13 UTSW 11 9,517,708 (GRCm39) missense probably damaging 0.97
R6021:Abca13 UTSW 11 9,240,465 (GRCm39) nonsense probably null
R6022:Abca13 UTSW 11 9,240,759 (GRCm39) missense probably damaging 1.00
R6032:Abca13 UTSW 11 9,247,752 (GRCm39) missense possibly damaging 0.52
R6032:Abca13 UTSW 11 9,247,752 (GRCm39) missense possibly damaging 0.52
R6105:Abca13 UTSW 11 9,347,812 (GRCm39) missense probably damaging 1.00
R6153:Abca13 UTSW 11 9,251,259 (GRCm39) critical splice acceptor site probably null
R6162:Abca13 UTSW 11 9,259,047 (GRCm39) missense probably damaging 1.00
R6187:Abca13 UTSW 11 9,259,085 (GRCm39) missense probably damaging 1.00
R6247:Abca13 UTSW 11 9,353,874 (GRCm39) missense probably benign 0.01
R6329:Abca13 UTSW 11 9,227,937 (GRCm39) missense probably damaging 1.00
R6352:Abca13 UTSW 11 9,259,139 (GRCm39) splice site probably null
R6367:Abca13 UTSW 11 9,166,248 (GRCm39) missense possibly damaging 0.85
R6423:Abca13 UTSW 11 9,248,778 (GRCm39) missense probably benign 0.01
R6424:Abca13 UTSW 11 9,460,542 (GRCm39) missense probably benign
R6456:Abca13 UTSW 11 9,240,474 (GRCm39) missense possibly damaging 0.94
R6490:Abca13 UTSW 11 9,248,661 (GRCm39) missense probably benign 0.00
R6547:Abca13 UTSW 11 9,224,757 (GRCm39) missense probably benign 0.04
R6594:Abca13 UTSW 11 9,244,632 (GRCm39) missense possibly damaging 0.52
R6604:Abca13 UTSW 11 9,328,384 (GRCm39) missense probably damaging 1.00
R6614:Abca13 UTSW 11 9,244,371 (GRCm39) missense probably benign 0.04
R6736:Abca13 UTSW 11 9,415,058 (GRCm39) missense probably damaging 1.00
R6742:Abca13 UTSW 11 9,278,168 (GRCm39) missense probably damaging 1.00
R6791:Abca13 UTSW 11 9,328,504 (GRCm39) missense probably damaging 1.00
R6834:Abca13 UTSW 11 9,225,110 (GRCm39) missense possibly damaging 0.48
R6936:Abca13 UTSW 11 9,248,568 (GRCm39) missense probably damaging 0.96
R6955:Abca13 UTSW 11 9,244,307 (GRCm39) missense probably benign 0.28
R7031:Abca13 UTSW 11 9,571,892 (GRCm39) missense probably damaging 1.00
R7065:Abca13 UTSW 11 9,242,595 (GRCm39) missense probably benign 0.02
R7067:Abca13 UTSW 11 9,241,845 (GRCm39) missense probably benign 0.14
R7070:Abca13 UTSW 11 9,240,701 (GRCm39) missense probably benign 0.06
R7094:Abca13 UTSW 11 9,248,610 (GRCm39) missense probably damaging 0.96
R7102:Abca13 UTSW 11 9,285,215 (GRCm39) missense probably damaging 1.00
R7105:Abca13 UTSW 11 9,347,842 (GRCm39) missense probably damaging 1.00
R7131:Abca13 UTSW 11 9,241,893 (GRCm39) missense probably benign 0.37
R7155:Abca13 UTSW 11 9,479,010 (GRCm39) missense probably benign
R7158:Abca13 UTSW 11 9,223,982 (GRCm39) missense probably benign
R7212:Abca13 UTSW 11 9,248,854 (GRCm39) missense probably benign 0.04
R7215:Abca13 UTSW 11 9,238,405 (GRCm39) splice site probably null
R7228:Abca13 UTSW 11 9,247,653 (GRCm39) missense probably benign
R7231:Abca13 UTSW 11 9,244,175 (GRCm39) missense probably benign 0.25
R7247:Abca13 UTSW 11 9,240,732 (GRCm39) missense probably benign 0.00
R7278:Abca13 UTSW 11 9,241,126 (GRCm39) missense possibly damaging 0.56
R7304:Abca13 UTSW 11 9,247,203 (GRCm39) missense probably benign
R7328:Abca13 UTSW 11 9,241,545 (GRCm39) missense probably benign 0.14
R7374:Abca13 UTSW 11 9,242,136 (GRCm39) missense possibly damaging 0.46
R7376:Abca13 UTSW 11 9,241,118 (GRCm39) missense probably benign 0.00
R7384:Abca13 UTSW 11 9,283,257 (GRCm39) missense probably damaging 1.00
R7395:Abca13 UTSW 11 9,241,658 (GRCm39) missense probably benign 0.01
R7419:Abca13 UTSW 11 9,247,833 (GRCm39) missense probably damaging 1.00
R7419:Abca13 UTSW 11 9,226,959 (GRCm39) missense probably damaging 1.00
R7421:Abca13 UTSW 11 9,460,463 (GRCm39) missense probably benign
R7458:Abca13 UTSW 11 9,240,777 (GRCm39) missense possibly damaging 0.94
R7474:Abca13 UTSW 11 9,278,088 (GRCm39) nonsense probably null
R7492:Abca13 UTSW 11 9,243,167 (GRCm39) missense probably benign 0.08
R7660:Abca13 UTSW 11 9,240,678 (GRCm39) missense probably benign 0.00
R7677:Abca13 UTSW 11 9,248,349 (GRCm39) nonsense probably null
R7744:Abca13 UTSW 11 9,240,421 (GRCm39) missense possibly damaging 0.88
R7790:Abca13 UTSW 11 9,247,915 (GRCm39) missense probably damaging 1.00
R7798:Abca13 UTSW 11 9,241,664 (GRCm39) missense probably benign 0.04
R7811:Abca13 UTSW 11 9,527,141 (GRCm39) splice site probably null
R7831:Abca13 UTSW 11 9,247,404 (GRCm39) missense possibly damaging 0.46
R7867:Abca13 UTSW 11 9,212,139 (GRCm39) critical splice donor site probably null
R7910:Abca13 UTSW 11 9,531,590 (GRCm39) missense probably damaging 1.00
R7964:Abca13 UTSW 11 9,266,146 (GRCm39) missense probably benign 0.06
R8037:Abca13 UTSW 11 9,243,904 (GRCm39) missense probably damaging 1.00
R8049:Abca13 UTSW 11 9,241,867 (GRCm39) missense probably damaging 0.99
R8059:Abca13 UTSW 11 9,323,279 (GRCm39) missense probably benign 0.00
R8072:Abca13 UTSW 11 9,244,574 (GRCm39) missense probably benign 0.10
R8078:Abca13 UTSW 11 9,251,279 (GRCm39) missense probably benign 0.32
R8112:Abca13 UTSW 11 9,264,624 (GRCm39) missense probably benign 0.01
R8146:Abca13 UTSW 11 9,347,829 (GRCm39) missense probably damaging 1.00
R8164:Abca13 UTSW 11 9,565,799 (GRCm39) missense probably damaging 1.00
R8195:Abca13 UTSW 11 9,224,735 (GRCm39) missense probably benign 0.00
R8220:Abca13 UTSW 11 9,384,299 (GRCm39) missense possibly damaging 0.58
R8235:Abca13 UTSW 11 9,212,077 (GRCm39) missense probably damaging 0.99
R8307:Abca13 UTSW 11 9,227,922 (GRCm39) nonsense probably null
R8310:Abca13 UTSW 11 9,328,269 (GRCm39) missense possibly damaging 0.90
R8315:Abca13 UTSW 11 9,535,502 (GRCm39) missense probably benign 0.44
R8315:Abca13 UTSW 11 9,328,460 (GRCm39) missense probably null 1.00
R8324:Abca13 UTSW 11 9,240,395 (GRCm39) missense probably damaging 1.00
R8375:Abca13 UTSW 11 9,347,841 (GRCm39) missense probably damaging 1.00
R8375:Abca13 UTSW 11 9,265,416 (GRCm39) missense probably benign 0.00
R8400:Abca13 UTSW 11 9,248,218 (GRCm39) missense probably damaging 0.97
R8400:Abca13 UTSW 11 9,243,925 (GRCm39) missense probably benign 0.00
R8425:Abca13 UTSW 11 9,264,623 (GRCm39) missense possibly damaging 0.92
R8486:Abca13 UTSW 11 9,225,092 (GRCm39) missense probably benign 0.00
R8493:Abca13 UTSW 11 9,460,668 (GRCm39) missense probably damaging 0.97
R8502:Abca13 UTSW 11 9,219,282 (GRCm39) missense probably benign 0.02
R8716:Abca13 UTSW 11 9,243,774 (GRCm39) missense probably benign 0.09
R8787:Abca13 UTSW 11 9,225,053 (GRCm39) missense possibly damaging 0.92
R8829:Abca13 UTSW 11 9,571,881 (GRCm39) missense probably damaging 1.00
R8859:Abca13 UTSW 11 9,328,397 (GRCm39) missense
R8871:Abca13 UTSW 11 9,248,071 (GRCm39) missense probably benign 0.07
R8883:Abca13 UTSW 11 9,283,168 (GRCm39) missense probably benign 0.00
R8919:Abca13 UTSW 11 9,241,653 (GRCm39) missense possibly damaging 0.84
R8966:Abca13 UTSW 11 9,578,588 (GRCm39) missense probably damaging 1.00
R8967:Abca13 UTSW 11 9,242,696 (GRCm39) missense probably benign 0.18
R8969:Abca13 UTSW 11 9,227,944 (GRCm39) missense probably benign
R8972:Abca13 UTSW 11 9,278,138 (GRCm39) missense probably damaging 1.00
R9002:Abca13 UTSW 11 9,241,926 (GRCm39) missense possibly damaging 0.94
R9046:Abca13 UTSW 11 9,243,525 (GRCm39) missense probably benign 0.04
R9051:Abca13 UTSW 11 9,285,232 (GRCm39) missense probably damaging 1.00
R9056:Abca13 UTSW 11 9,414,921 (GRCm39) missense probably damaging 1.00
R9061:Abca13 UTSW 11 9,227,847 (GRCm39) missense probably benign 0.02
R9072:Abca13 UTSW 11 9,240,834 (GRCm39) missense possibly damaging 0.93
R9090:Abca13 UTSW 11 9,241,698 (GRCm39) missense probably damaging 0.98
R9127:Abca13 UTSW 11 9,242,080 (GRCm39) missense probably benign 0.03
R9164:Abca13 UTSW 11 9,278,157 (GRCm39) missense probably damaging 1.00
R9175:Abca13 UTSW 11 9,531,593 (GRCm39) missense probably damaging 0.98
R9190:Abca13 UTSW 11 9,241,886 (GRCm39) missense probably damaging 0.96
R9244:Abca13 UTSW 11 9,241,577 (GRCm39) missense probably benign 0.01
R9255:Abca13 UTSW 11 9,278,213 (GRCm39) missense probably damaging 1.00
R9271:Abca13 UTSW 11 9,241,698 (GRCm39) missense probably damaging 0.98
R9321:Abca13 UTSW 11 9,460,475 (GRCm39) missense probably benign 0.00
R9356:Abca13 UTSW 11 9,206,305 (GRCm39) missense probably benign 0.11
R9369:Abca13 UTSW 11 9,328,444 (GRCm39) missense probably damaging 1.00
R9423:Abca13 UTSW 11 9,240,395 (GRCm39) missense probably damaging 1.00
R9432:Abca13 UTSW 11 9,244,559 (GRCm39) missense probably benign 0.00
R9455:Abca13 UTSW 11 9,353,897 (GRCm39) missense probably damaging 1.00
R9486:Abca13 UTSW 11 9,240,621 (GRCm39) missense possibly damaging 0.88
R9492:Abca13 UTSW 11 9,243,667 (GRCm39) nonsense probably null
R9511:Abca13 UTSW 11 9,278,130 (GRCm39) missense probably benign 0.16
R9545:Abca13 UTSW 11 9,416,538 (GRCm39) missense probably damaging 1.00
R9566:Abca13 UTSW 11 9,414,927 (GRCm39) missense probably damaging 1.00
R9609:Abca13 UTSW 11 9,208,549 (GRCm39) missense probably damaging 1.00
R9616:Abca13 UTSW 11 9,240,501 (GRCm39) missense probably benign 0.00
R9651:Abca13 UTSW 11 9,535,484 (GRCm39) missense probably benign
R9651:Abca13 UTSW 11 9,243,741 (GRCm39) missense probably benign 0.31
R9653:Abca13 UTSW 11 9,243,741 (GRCm39) missense probably benign 0.31
R9657:Abca13 UTSW 11 9,243,379 (GRCm39) missense probably benign 0.35
R9684:Abca13 UTSW 11 9,283,307 (GRCm39) missense probably damaging 1.00
X0013:Abca13 UTSW 11 9,223,899 (GRCm39) missense probably benign 0.02
X0057:Abca13 UTSW 11 9,244,744 (GRCm39) missense probably damaging 0.96
X0066:Abca13 UTSW 11 9,217,565 (GRCm39) missense probably damaging 0.96
Z1088:Abca13 UTSW 11 9,244,687 (GRCm39) missense probably damaging 0.99
Z1176:Abca13 UTSW 11 9,217,461 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,201,376 (GRCm39) missense possibly damaging 0.88
Z1176:Abca13 UTSW 11 9,285,182 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,285,181 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,244,342 (GRCm39) missense probably benign 0.01
Z1177:Abca13 UTSW 11 9,264,545 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGAACTCCTGGATTCATCACC -3'
(R):5'- GCGTGCTTCAAGATGAGATTC -3'

Sequencing Primer
(F):5'- CCTGGATTCATCACCATTGAAG -3'
(R):5'- CGTGCTTCAAGATGAGATTCATGAG -3'
Posted On 2019-06-26