Incidental Mutation 'R7299:Ddx24'
ID566882
Institutional Source Beutler Lab
Gene Symbol Ddx24
Ensembl Gene ENSMUSG00000041645
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 24
Synonyms2510027P10Rik, 1700055J08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7299 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location103407982-103425830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103419450 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 298 (M298T)
Ref Sequence ENSEMBL: ENSMUSP00000105628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044923] [ENSMUST00000110001] [ENSMUST00000220975] [ENSMUST00000221211] [ENSMUST00000223233]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044923
AA Change: M252T

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040890
Gene: ENSMUSG00000041645
AA Change: M252T

DomainStartEndE-ValueType
low complexity region 94 101 N/A INTRINSIC
low complexity region 105 114 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
low complexity region 168 180 N/A INTRINSIC
DEXDc 212 541 1.14e-39 SMART
HELICc 601 682 5.22e-25 SMART
low complexity region 752 766 N/A INTRINSIC
low complexity region 775 787 N/A INTRINSIC
low complexity region 835 852 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110001
AA Change: M298T

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105628
Gene: ENSMUSG00000041645
AA Change: M298T

DomainStartEndE-ValueType
low complexity region 140 147 N/A INTRINSIC
low complexity region 151 160 N/A INTRINSIC
low complexity region 200 208 N/A INTRINSIC
low complexity region 214 226 N/A INTRINSIC
DEXDc 258 587 1.14e-39 SMART
HELICc 647 728 5.22e-25 SMART
low complexity region 798 812 N/A INTRINSIC
low complexity region 821 833 N/A INTRINSIC
low complexity region 881 898 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220975
Predicted Effect possibly damaging
Transcript: ENSMUST00000221211
AA Change: M252T

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000222782
Predicted Effect probably benign
Transcript: ENSMUST00000223233
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which shows little similarity to any of the other known human DEAD box proteins, but shows a high similarity to mouse Ddx24 at the amino acid level. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout is embryonic lethal: embryos die between implantation and placentation. Heterozygous KO animals are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A C 3: 121,679,446 K83N unknown Het
Abca13 A T 11: 9,294,649 N2171Y probably damaging Het
Abcc8 G A 7: 46,105,498 T1532I possibly damaging Het
Abtb2 A T 2: 103,702,424 probably null Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Akap9 C A 5: 4,032,696 T1940K probably damaging Het
Armc4 T C 18: 7,222,635 K545E probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc8 A G 7: 16,996,031 T482A unknown Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cenpt G A 8: 105,849,904 Q45* probably null Het
Cnga1 T C 5: 72,605,432 I246M probably benign Het
Cnot7 A G 8: 40,507,545 I74T probably damaging Het
Cog6 T C 3: 53,002,507 S275G probably benign Het
Csmd2 C A 4: 128,528,262 D2797E Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Ergic2 T A 6: 148,188,112 Y249F probably damaging Het
Exoc1 T A 5: 76,542,159 M182K probably damaging Het
Fhdc1 T C 3: 84,444,540 E1126G probably damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gap43 T C 16: 42,292,252 K49E probably damaging Het
Gata4 T A 14: 63,203,742 T276S probably damaging Het
Gca C T 2: 62,689,976 P160L probably benign Het
Ghdc C T 11: 100,768,116 V397I possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gtf3c3 G A 1: 54,417,708 P511L probably benign Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Itgb8 T C 12: 119,202,461 N112D probably benign Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Krtap26-1 T C 16: 88,647,244 Y163C possibly damaging Het
Kyat1 T C 2: 30,191,995 D44G probably benign Het
Mob1a G A 6: 83,338,449 probably null Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Nhsl1 A G 10: 18,527,671 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1496 G A 19: 13,781,324 W235* probably null Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Ptpro G A 6: 137,441,144 probably null Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Ralgps1 T C 2: 33,157,873 K365R probably benign Het
Reep1 A T 6: 71,761,389 I44L probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmem263 T A 10: 85,114,397 probably null Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Tnrc6a A C 7: 123,170,913 N642T probably benign Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Trak1 A G 9: 121,451,863 probably null Het
Trpc4 T C 3: 54,317,627 I799T possibly damaging Het
Ttc7 T C 17: 87,346,542 I549T possibly damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Wrn A G 8: 33,292,718 F728S probably damaging Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfp418 T A 7: 7,182,828 C597S possibly damaging Het
Zfp568 A G 7: 30,017,244 T190A probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Other mutations in Ddx24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Ddx24 APN 12 103418202 missense probably damaging 0.97
IGL02102:Ddx24 APN 12 103408484 intron probably benign
IGL02225:Ddx24 APN 12 103417371 missense probably damaging 1.00
IGL02226:Ddx24 APN 12 103424458 missense possibly damaging 0.81
IGL02325:Ddx24 APN 12 103416266 missense probably damaging 1.00
IGL02568:Ddx24 APN 12 103417312 missense probably damaging 1.00
IGL02666:Ddx24 APN 12 103424055 missense possibly damaging 0.94
IGL02950:Ddx24 APN 12 103417542 missense probably damaging 1.00
IGL03244:Ddx24 APN 12 103417605 missense possibly damaging 0.53
P0028:Ddx24 UTSW 12 103408375 missense probably benign
R0195:Ddx24 UTSW 12 103418961 critical splice donor site probably null
R0540:Ddx24 UTSW 12 103419067 missense possibly damaging 0.92
R0607:Ddx24 UTSW 12 103419067 missense possibly damaging 0.92
R0621:Ddx24 UTSW 12 103425558 intron probably benign
R0964:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R1447:Ddx24 UTSW 12 103424307 missense possibly damaging 0.88
R1639:Ddx24 UTSW 12 103411319 critical splice acceptor site probably null
R1909:Ddx24 UTSW 12 103409982 missense probably damaging 0.99
R2418:Ddx24 UTSW 12 103417737 missense probably damaging 1.00
R3706:Ddx24 UTSW 12 103417416 missense probably damaging 1.00
R3725:Ddx24 UTSW 12 103417605 missense probably benign 0.19
R4436:Ddx24 UTSW 12 103423974 missense probably damaging 1.00
R4807:Ddx24 UTSW 12 103419461 missense probably damaging 1.00
R5568:Ddx24 UTSW 12 103424288 missense possibly damaging 0.46
R5629:Ddx24 UTSW 12 103425547 intron probably benign
R5763:Ddx24 UTSW 12 103417414 missense probably damaging 1.00
R5891:Ddx24 UTSW 12 103424058 missense probably damaging 1.00
R6059:Ddx24 UTSW 12 103408300 missense probably damaging 1.00
R6310:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R6311:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R6408:Ddx24 UTSW 12 103425560 intron probably benign
R6648:Ddx24 UTSW 12 103408375 missense probably benign 0.02
R7151:Ddx24 UTSW 12 103424088 missense probably benign 0.00
R7301:Ddx24 UTSW 12 103419450 missense possibly damaging 0.95
R7324:Ddx24 UTSW 12 103416259 missense probably damaging 1.00
R7513:Ddx24 UTSW 12 103419106 nonsense probably null
R7602:Ddx24 UTSW 12 103416260 nonsense probably null
R7734:Ddx24 UTSW 12 103417560 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AGGCACTAGTCTCAGGTGTG -3'
(R):5'- TTCCTTGATAGCCAGGTGC -3'

Sequencing Primer
(F):5'- CACTGGGCTGTGCTTCAGTC -3'
(R):5'- GCGCTGGAGGAACCTGTG -3'
Posted On2019-06-26