Incidental Mutation 'R7299:Gata4'
ID566891
Institutional Source Beutler Lab
Gene Symbol Gata4
Ensembl Gene ENSMUSG00000021944
Gene NameGATA binding protein 4
SynonymsGata-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7299 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location63198922-63271692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63203742 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 276 (T276S)
Ref Sequence ENSEMBL: ENSMUSP00000066927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067417] [ENSMUST00000118022] [ENSMUST00000121312]
Predicted Effect probably damaging
Transcript: ENSMUST00000067417
AA Change: T276S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066927
Gene: ENSMUSG00000021944
AA Change: T276S

DomainStartEndE-ValueType
Pfam:GATA-N 1 204 2.2e-54 PFAM
ZnF_GATA 211 261 4.36e-18 SMART
ZnF_GATA 265 315 1.02e-23 SMART
low complexity region 342 360 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118022
AA Change: T275S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113891
Gene: ENSMUSG00000021944
AA Change: T275S

DomainStartEndE-ValueType
Pfam:GATA-N 1 207 7.8e-54 PFAM
ZnF_GATA 210 260 4.36e-18 SMART
ZnF_GATA 264 314 1.02e-23 SMART
low complexity region 341 359 N/A INTRINSIC
low complexity region 372 389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121312
AA Change: T70S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113451
Gene: ENSMUSG00000021944
AA Change: T70S

DomainStartEndE-ValueType
ZnF_GATA 5 55 4.36e-18 SMART
ZnF_GATA 59 109 1.02e-23 SMART
low complexity region 136 154 N/A INTRINSIC
low complexity region 167 184 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GATA family of zinc-finger transcription factors. Members of this family recognize the GATA motif which is present in the promoters of many genes. This protein is thought to regulate genes involved in embryogenesis and in myocardial differentiation and function, and is necessary for normal testicular development. Mutations in this gene have been associated with cardiac septal defects. Additionally, alterations in gene expression have been associated with several cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in ventral morphogenesis, lack a primitive heart tube and foregut, develop partially outside the yolk sac, and die by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A C 3: 121,679,446 K83N unknown Het
Abca13 A T 11: 9,294,649 N2171Y probably damaging Het
Abcc8 G A 7: 46,105,498 T1532I possibly damaging Het
Abtb2 A T 2: 103,702,424 probably null Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Akap9 C A 5: 4,032,696 T1940K probably damaging Het
Armc4 T C 18: 7,222,635 K545E probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc8 A G 7: 16,996,031 T482A unknown Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cenpt G A 8: 105,849,904 Q45* probably null Het
Cnga1 T C 5: 72,605,432 I246M probably benign Het
Cnot7 A G 8: 40,507,545 I74T probably damaging Het
Cog6 T C 3: 53,002,507 S275G probably benign Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Ergic2 T A 6: 148,188,112 Y249F probably damaging Het
Exoc1 T A 5: 76,542,159 M182K probably damaging Het
Fhdc1 T C 3: 84,444,540 E1126G probably damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gap43 T C 16: 42,292,252 K49E probably damaging Het
Gca C T 2: 62,689,976 P160L probably benign Het
Ghdc C T 11: 100,768,116 V397I possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gtf3c3 G A 1: 54,417,708 P511L probably benign Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Itgb8 T C 12: 119,202,461 N112D probably benign Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Krtap26-1 T C 16: 88,647,244 Y163C possibly damaging Het
Kyat1 T C 2: 30,191,995 D44G probably benign Het
Mob1a G A 6: 83,338,449 probably null Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Nhsl1 A G 10: 18,527,671 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1496 G A 19: 13,781,324 W235* probably null Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Ptpro G A 6: 137,441,144 probably null Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Ralgps1 T C 2: 33,157,873 K365R probably benign Het
Reep1 A T 6: 71,761,389 I44L probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmem263 T A 10: 85,114,397 probably null Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Tnrc6a A C 7: 123,170,913 N642T probably benign Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Trak1 A G 9: 121,451,863 probably null Het
Trpc4 T C 3: 54,317,627 I799T possibly damaging Het
Ttc7 T C 17: 87,346,542 I549T possibly damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Wrn A G 8: 33,292,718 F728S probably damaging Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfp418 T A 7: 7,182,828 C597S possibly damaging Het
Zfp568 A G 7: 30,017,244 T190A probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Other mutations in Gata4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Gata4 APN 14 63200463 missense possibly damaging 0.53
IGL02481:Gata4 APN 14 63200461 missense probably benign 0.01
IGL02483:Gata4 APN 14 63200461 missense probably benign 0.01
IGL02643:Gata4 APN 14 63204755 missense possibly damaging 0.85
R0034:Gata4 UTSW 14 63201484 missense probably benign 0.00
R0043:Gata4 UTSW 14 63203301 splice site probably benign
R1131:Gata4 UTSW 14 63204740 missense possibly damaging 0.71
R1880:Gata4 UTSW 14 63204695 missense probably damaging 1.00
R3500:Gata4 UTSW 14 63200533 missense possibly damaging 0.84
R3949:Gata4 UTSW 14 63240697 missense possibly damaging 0.95
R4893:Gata4 UTSW 14 63201596 missense probably benign 0.01
R4976:Gata4 UTSW 14 63203689 missense probably damaging 1.00
R5152:Gata4 UTSW 14 63241121 missense probably damaging 1.00
R5198:Gata4 UTSW 14 63200451 missense probably benign 0.09
R5237:Gata4 UTSW 14 63240626 missense probably benign 0.28
R5291:Gata4 UTSW 14 63240599 missense probably damaging 0.98
R5358:Gata4 UTSW 14 63240626 missense probably benign 0.28
R5693:Gata4 UTSW 14 63241145 missense probably damaging 1.00
R7143:Gata4 UTSW 14 63204617 missense probably damaging 1.00
R7729:Gata4 UTSW 14 63240737 missense probably benign 0.00
R7849:Gata4 UTSW 14 63204725 missense possibly damaging 0.92
R7932:Gata4 UTSW 14 63204725 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCAGTGAGACCTGCAGAATG -3'
(R):5'- TTCATGAATTCCACCTTGGGGAAG -3'

Sequencing Primer
(F):5'- CCTGCAGAATGGGAGTGG -3'
(R):5'- TCTGTTGACCGAGGCTCC -3'
Posted On2019-06-26