Incidental Mutation 'R7299:Armc4'
ID566898
Institutional Source Beutler Lab
Gene Symbol Armc4
Ensembl Gene ENSMUSG00000061802
Gene Namearmadillo repeat containing 4
Synonymsb2b643Clo, 4930463I21Rik, b2b227.1Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R7299 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location7088233-7297901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7222635 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 545 (K545E)
Ref Sequence ENSEMBL: ENSMUSP00000080028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081275]
Predicted Effect probably damaging
Transcript: ENSMUST00000081275
AA Change: K545E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080028
Gene: ENSMUSG00000061802
AA Change: K545E

DomainStartEndE-ValueType
low complexity region 172 186 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
ARM 475 516 1.38e1 SMART
ARM 517 557 2.38e-2 SMART
ARM 558 613 3.97e0 SMART
ARM 614 654 2.59e-3 SMART
ARM 655 695 3.48e1 SMART
ARM 696 737 1.6e1 SMART
ARM 738 778 4.09e0 SMART
ARM 779 819 9.68e0 SMART
ARM 861 903 3.52e0 SMART
ARM 904 944 1.26e1 SMART
ARM 945 985 1.03e1 SMART
ARM 986 1026 1.13e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. This protein has been shown to localize to the ciliary axonemes and at the ciliary base of respiratory cells. Studies indicate that mutations in this gene cause partial outer dynein arm (ODA) defects in respiratory cilia. The cilia of cells with mutations in this gene displayed either reduced ciliary beat frequency and amplitude, or, complete immotility. Some individuals with primary ciliary dyskensia (PCD) have been shown to have mutations in this gene. PCD is characterized by chronic airway disease and left/right body asymmetry defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit situs inversus totalis or heterotaxia with congenital heart disease including double outlet right ventricle and ventricular septal defects. Dyskinetic, slow, or immotile airway cilia are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A C 3: 121,679,446 K83N unknown Het
Abca13 A T 11: 9,294,649 N2171Y probably damaging Het
Abcc8 G A 7: 46,105,498 T1532I possibly damaging Het
Abtb2 A T 2: 103,702,424 probably null Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Akap9 C A 5: 4,032,696 T1940K probably damaging Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc8 A G 7: 16,996,031 T482A unknown Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cenpt G A 8: 105,849,904 Q45* probably null Het
Cnga1 T C 5: 72,605,432 I246M probably benign Het
Cnot7 A G 8: 40,507,545 I74T probably damaging Het
Cog6 T C 3: 53,002,507 S275G probably benign Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Ergic2 T A 6: 148,188,112 Y249F probably damaging Het
Exoc1 T A 5: 76,542,159 M182K probably damaging Het
Fhdc1 T C 3: 84,444,540 E1126G probably damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gap43 T C 16: 42,292,252 K49E probably damaging Het
Gata4 T A 14: 63,203,742 T276S probably damaging Het
Gca C T 2: 62,689,976 P160L probably benign Het
Ghdc C T 11: 100,768,116 V397I possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gtf3c3 G A 1: 54,417,708 P511L probably benign Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Itgb8 T C 12: 119,202,461 N112D probably benign Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Krtap26-1 T C 16: 88,647,244 Y163C possibly damaging Het
Kyat1 T C 2: 30,191,995 D44G probably benign Het
Mob1a G A 6: 83,338,449 probably null Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Nhsl1 A G 10: 18,527,671 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1496 G A 19: 13,781,324 W235* probably null Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Ptpro G A 6: 137,441,144 probably null Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Ralgps1 T C 2: 33,157,873 K365R probably benign Het
Reep1 A T 6: 71,761,389 I44L probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmem263 T A 10: 85,114,397 probably null Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Tnrc6a A C 7: 123,170,913 N642T probably benign Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Trak1 A G 9: 121,451,863 probably null Het
Trpc4 T C 3: 54,317,627 I799T possibly damaging Het
Ttc7 T C 17: 87,346,542 I549T possibly damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Wrn A G 8: 33,292,718 F728S probably damaging Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfp418 T A 7: 7,182,828 C597S possibly damaging Het
Zfp568 A G 7: 30,017,244 T190A probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Other mutations in Armc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Armc4 APN 18 7211504 missense probably damaging 0.96
IGL00822:Armc4 APN 18 7181817 missense probably damaging 1.00
IGL01345:Armc4 APN 18 7266947 missense probably benign 0.00
IGL01593:Armc4 APN 18 7127345 missense probably benign 0.00
IGL01645:Armc4 APN 18 7268491 missense probably benign 0.00
IGL01863:Armc4 APN 18 7222617 missense probably damaging 1.00
IGL01955:Armc4 APN 18 7127291 missense possibly damaging 0.89
IGL02013:Armc4 APN 18 7265157 splice site probably benign
IGL02142:Armc4 APN 18 7214601 missense probably damaging 1.00
IGL02399:Armc4 APN 18 7285719 missense probably benign
IGL02439:Armc4 APN 18 7268444 missense probably benign 0.04
IGL02452:Armc4 APN 18 7129461 missense probably damaging 1.00
IGL02632:Armc4 APN 18 7214727 splice site probably benign
IGL03344:Armc4 APN 18 7129434 nonsense probably null
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0365:Armc4 UTSW 18 7217800 missense probably benign 0.01
R0377:Armc4 UTSW 18 7127415 missense probably benign 0.04
R0466:Armc4 UTSW 18 7286758 missense probably benign 0.10
R0517:Armc4 UTSW 18 7223621 missense probably damaging 1.00
R0521:Armc4 UTSW 18 7222676 missense possibly damaging 0.64
R0841:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1435:Armc4 UTSW 18 7222646 missense probably benign 0.01
R1487:Armc4 UTSW 18 7273245 missense probably damaging 0.98
R1634:Armc4 UTSW 18 7286688 missense probably damaging 0.99
R1677:Armc4 UTSW 18 7222554 missense probably benign 0.01
R1778:Armc4 UTSW 18 7127388 missense probably damaging 1.00
R1792:Armc4 UTSW 18 7286743 missense probably benign 0.00
R1809:Armc4 UTSW 18 7211630 missense probably benign 0.08
R1842:Armc4 UTSW 18 7223551 missense probably benign 0.04
R2144:Armc4 UTSW 18 7127229 missense probably damaging 0.96
R2206:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2273:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2275:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2918:Armc4 UTSW 18 7222625 missense probably benign 0.04
R3421:Armc4 UTSW 18 7223523 splice site probably benign
R3422:Armc4 UTSW 18 7223523 splice site probably benign
R4165:Armc4 UTSW 18 7217008 missense probably damaging 1.00
R4225:Armc4 UTSW 18 7181732 critical splice donor site probably null
R4660:Armc4 UTSW 18 7211609 missense possibly damaging 0.88
R4745:Armc4 UTSW 18 7286763 missense probably benign 0.28
R4812:Armc4 UTSW 18 7288634 missense possibly damaging 0.79
R4831:Armc4 UTSW 18 7222564 missense possibly damaging 0.79
R4923:Armc4 UTSW 18 7181787 missense probably damaging 0.97
R4995:Armc4 UTSW 18 7223663 missense probably damaging 1.00
R5024:Armc4 UTSW 18 7088555 missense probably benign 0.02
R5335:Armc4 UTSW 18 7294566 missense probably benign 0.06
R5434:Armc4 UTSW 18 7222550 missense probably benign 0.03
R5552:Armc4 UTSW 18 7285360 missense possibly damaging 0.51
R5719:Armc4 UTSW 18 7211496 missense probably benign 0.00
R5736:Armc4 UTSW 18 7268416 missense probably benign 0.01
R5792:Armc4 UTSW 18 7217965 missense probably benign 0.00
R5848:Armc4 UTSW 18 7268507 synonymous probably null
R5957:Armc4 UTSW 18 7285706 missense probably benign 0.01
R6001:Armc4 UTSW 18 7286838 missense probably benign 0.03
R6309:Armc4 UTSW 18 7214617 missense probably benign 0.04
R6559:Armc4 UTSW 18 7223664 missense probably damaging 0.99
R6574:Armc4 UTSW 18 7129394 splice site probably null
R6581:Armc4 UTSW 18 7129560 missense possibly damaging 0.77
R6736:Armc4 UTSW 18 7223586 missense probably damaging 0.98
R6842:Armc4 UTSW 18 7268401 missense probably benign 0.00
R6968:Armc4 UTSW 18 7273155 splice site probably null
R6974:Armc4 UTSW 18 7294479 missense probably benign 0.37
R7024:Armc4 UTSW 18 7211593 missense probably benign 0.43
R7578:Armc4 UTSW 18 7211593 missense probably benign 0.43
R7737:Armc4 UTSW 18 7217890 missense probably damaging 1.00
R7878:Armc4 UTSW 18 7217801 missense probably benign 0.01
R7961:Armc4 UTSW 18 7217801 missense probably benign 0.01
Z1088:Armc4 UTSW 18 7266919 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGATGACTAGATGCACAAAGC -3'
(R):5'- GGAATGGCCCTTAGGTAGAC -3'

Sequencing Primer
(F):5'- GCACAAAGCATCAGATAAGACCAG -3'
(R):5'- AGGCCCCTTGGTATTGCAAAC -3'
Posted On2019-06-26