Incidental Mutation 'R7300:Mstn'
ID566902
Institutional Source Beutler Lab
Gene Symbol Mstn
Ensembl Gene ENSMUSG00000026100
Gene Namemyostatin
SynonymsGdf8
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R7300 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location53061640-53068079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53064080 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 192 (S192P)
Ref Sequence ENSEMBL: ENSMUSP00000027269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027269] [ENSMUST00000191197]
PDB Structure
Crystal structure of the myostatin:follistatin 288 complex [X-RAY DIFFRACTION]
Crystal Structure of the Myostatin:Follistatin-like 3 Complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027269
AA Change: S192P

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027269
Gene: ENSMUSG00000026100
AA Change: S192P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TGFb_propeptide 38 266 1.3e-30 PFAM
TGFB 282 376 2.31e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191197
SMART Domains Protein: ENSMUSP00000140249
Gene: ENSMUSG00000026100

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 13 188 1.3e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein negatively regulates skeletal muscle cell proliferation and differentiation. Homozygous knockout mice for this gene exhibit increased muscle mass and bone density, and reduced adiposity. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit markedly increased size of striated muscle due to both hyperplasia and hypertrophy, reduced adiposity, and increased bone mineral density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T C 5: 129,097,347 probably null Het
Atr T C 9: 95,865,370 I235T probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bpifb5 A G 2: 154,228,146 E172G possibly damaging Het
Btbd2 A T 10: 80,644,266 I420N probably damaging Het
C330027C09Rik A G 16: 49,013,854 K631E probably damaging Het
Ccdc141 G A 2: 77,014,694 T1343I probably benign Het
Cd59b A T 2: 104,084,450 K64N possibly damaging Het
Cd63 A G 10: 128,912,165 N144S probably benign Het
Col4a4 C T 1: 82,486,640 R989Q unknown Het
Cyp4a31 A G 4: 115,570,271 T225A probably benign Het
Dnah1 T G 14: 31,269,841 E3068A probably benign Het
Fpgt C T 3: 155,086,975 V472I probably damaging Het
Gm3147 A T 5: 94,612,796 D340E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Homer3 T C 8: 70,285,303 M1T probably null Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Il2ra A G 2: 11,676,910 T109A not run Het
Itgb6 T C 2: 60,605,306 D700G probably benign Het
Krt31 T C 11: 100,047,786 E327G probably damaging Het
Large1 A C 8: 72,837,596 L514R probably damaging Het
Map3k8 C T 18: 4,349,076 V81M probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1061 T C 2: 86,413,986 E22G probably null Het
Olfr135 A C 17: 38,208,697 T151P possibly damaging Het
Olfr1386 C T 11: 49,470,646 T165I probably benign Het
Olfr556 A G 7: 102,670,210 S97G probably benign Het
Olfr60 A T 7: 140,345,355 N211K probably damaging Het
Olfr829 T C 9: 18,857,234 I194T not run Het
Pde4a T C 9: 21,206,322 S627P probably damaging Het
Pdxdc1 A G 16: 13,879,510 I102T probably damaging Het
Phldb2 A G 16: 45,825,562 S174P probably damaging Het
Pla2g4e C T 2: 120,191,199 V143I probably damaging Het
Pou4f2 C T 8: 78,436,106 probably null Het
Ppl C T 16: 5,102,371 V387M possibly damaging Het
Rarg A T 15: 102,252,417 probably null Het
Ryr1 T C 7: 29,059,511 Y3414C probably damaging Het
Serpinb8 T A 1: 107,607,323 *375K probably null Het
Sim1 C T 10: 50,909,518 H228Y probably benign Het
Spag4 A T 2: 156,065,621 H87L probably benign Het
Ttc17 A T 2: 94,375,134 L289Q probably damaging Het
Ubac2 T C 14: 121,905,174 L28P probably damaging Het
Vmn2r31 C A 7: 7,384,776 A599S possibly damaging Het
Vps13c T C 9: 67,940,544 V2196A probably benign Het
Zswim5 A T 4: 116,975,905 I612F probably damaging Het
Zzef1 T A 11: 72,875,004 H1452Q probably benign Het
Other mutations in Mstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Mstn APN 1 53061997 missense possibly damaging 0.47
IGL01432:Mstn APN 1 53066530 missense possibly damaging 0.65
IGL02009:Mstn APN 1 53062150 splice site probably benign
IGL02547:Mstn APN 1 53064125 missense probably benign 0.08
PIT4403001:Mstn UTSW 1 53061785 missense probably benign 0.00
R0499:Mstn UTSW 1 53063984 missense probably damaging 1.00
R0556:Mstn UTSW 1 53064125 missense probably benign 0.08
R0730:Mstn UTSW 1 53061794 missense possibly damaging 0.81
R1180:Mstn UTSW 1 53064008 missense possibly damaging 0.93
R1472:Mstn UTSW 1 53061998 missense probably damaging 0.99
R1659:Mstn UTSW 1 53064077 nonsense probably null
R1676:Mstn UTSW 1 53062065 missense probably benign 0.08
R1753:Mstn UTSW 1 53066558 missense probably damaging 1.00
R3852:Mstn UTSW 1 53061971 missense possibly damaging 0.78
R4773:Mstn UTSW 1 53062108 missense probably benign 0.18
R4938:Mstn UTSW 1 53066423 missense possibly damaging 0.90
R6000:Mstn UTSW 1 53061669 start gained probably benign
R6393:Mstn UTSW 1 53066489 missense probably benign 0.00
R6991:Mstn UTSW 1 53061941 missense probably benign 0.02
R7018:Mstn UTSW 1 53064084 missense possibly damaging 0.51
R7077:Mstn UTSW 1 53064249 missense probably benign 0.30
R7170:Mstn UTSW 1 53066395 missense probably damaging 1.00
R7486:Mstn UTSW 1 53063969 missense probably damaging 1.00
R8063:Mstn UTSW 1 53066448 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGCCTGATGTCAGTCATTTTC -3'
(R):5'- ATCTTCTCCTGGTCCTGGGAAG -3'

Sequencing Primer
(F):5'- AGCTGACTTTCTAATGCAAGCGG -3'
(R):5'- GGTTACAGCAAGATCATGGCCATTC -3'
Posted On2019-06-26